Incidental Mutation 'R1449:Olfr740'
ID 159168
Institutional Source Beutler Lab
Gene Symbol Olfr740
Ensembl Gene ENSMUSG00000095917
Gene Name olfactory receptor 740
Synonyms MOR106-4, GA_x6K02T2PMLR-6167145-6168080
MMRRC Submission 039504-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R1449 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 50445545-50456933 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 50453921 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 290 (N290D)
Ref Sequence ENSEMBL: ENSMUSP00000148916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089838] [ENSMUST00000214792]
AlphaFold E9PV79
Predicted Effect probably damaging
Transcript: ENSMUST00000089838
AA Change: N290D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087276
Gene: ENSMUSG00000095917
AA Change: N290D

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.3e-56 PFAM
Pfam:7tm_1 45 294 1.6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214792
AA Change: N290D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A G 4: 137,455,355 N274D possibly damaging Het
6430571L13Rik T A 9: 107,342,490 N47K probably damaging Het
Aasdh C T 5: 76,886,289 A472T probably benign Het
Abca13 A G 11: 9,298,580 T2776A probably damaging Het
Adamts10 T A 17: 33,545,639 V711D probably damaging Het
Adrb3 G A 8: 27,227,387 R345C probably damaging Het
Ak7 T C 12: 105,742,261 V325A possibly damaging Het
Armc6 G A 8: 70,225,293 L129F probably benign Het
Bend6 T C 1: 33,878,343 N10S probably benign Het
Bmpr1b T C 3: 141,871,373 E59G possibly damaging Het
Brd3 A G 2: 27,450,251 probably null Het
Brd3 A G 2: 27,457,016 Y369H probably damaging Het
Cacna1e C T 1: 154,485,662 probably null Het
Camk4 A G 18: 32,939,475 D27G probably damaging Het
Camkk1 T G 11: 73,033,884 S308A probably damaging Het
Catsperb A G 12: 101,588,197 T717A probably benign Het
Cdh23 A T 10: 60,376,951 S1563R probably damaging Het
Cep44 A T 8: 56,540,950 S197R probably benign Het
Col3a1 T A 1: 45,321,611 I67N unknown Het
Dcaf12l1 T C X: 44,789,427 T165A probably benign Het
Dicer1 T C 12: 104,729,243 Y143C possibly damaging Het
Dlg5 A G 14: 24,135,643 I1898T possibly damaging Het
Dnah1 T C 14: 31,263,951 N3762D probably damaging Het
Dscaml1 A T 9: 45,742,223 T1382S possibly damaging Het
Entpd3 A T 9: 120,566,489 R513W probably damaging Het
Foxred1 A G 9: 35,209,442 S132P probably damaging Het
Ftsj3 T C 11: 106,253,000 I273V probably benign Het
Hsd17b7 C T 1: 169,959,682 probably null Het
Iars T A 13: 49,733,710 V1253D probably damaging Het
Iqsec1 T A 6: 90,690,808 K216* probably null Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Kcnk2 G A 1: 189,340,026 S35L probably benign Het
Kif13a T C 13: 46,812,736 Y402C probably damaging Het
Lamc1 A G 1: 153,250,495 S484P probably benign Het
Lap3 T C 5: 45,509,519 probably null Het
Lhx8 G T 3: 154,328,105 S46* probably null Het
Lin7a T C 10: 107,323,952 S42P probably damaging Het
Lrba G A 3: 86,354,278 R1513Q probably damaging Het
Maml2 C A 9: 13,620,684 P398Q possibly damaging Het
Mast2 T C 4: 116,309,013 I1201V probably damaging Het
Mmp20 A T 9: 7,642,768 D201V probably damaging Het
Morn5 T A 2: 36,057,080 C123* probably null Het
Mrpl4 A G 9: 21,007,511 K175E possibly damaging Het
Nav3 A T 10: 109,853,511 S302T probably benign Het
Ndrg2 T C 14: 51,908,134 Y217C probably damaging Het
Nfx1 A G 4: 40,976,803 D159G probably damaging Het
Nlrp9b A T 7: 20,023,164 T109S possibly damaging Het
Npepps A G 11: 97,207,154 Y909H probably benign Het
Olfr1510 A G 14: 52,410,567 C102R probably damaging Het
Olfr559 A T 7: 102,724,190 F100Y probably damaging Het
Olfr801 T A 10: 129,670,369 D50V probably damaging Het
Olfr810 A C 10: 129,790,854 V245G probably damaging Het
Pcdh1 T C 18: 38,189,876 H968R probably damaging Het
Pde1b T A 15: 103,525,043 I296N probably damaging Het
Phldb1 T A 9: 44,716,633 T172S probably benign Het
Plxdc2 T C 2: 16,660,781 V215A possibly damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
Pou6f2 G T 13: 18,172,415 Q31K probably damaging Het
Psd T A 19: 46,324,811 Y40F probably damaging Het
Rnf126 T C 10: 79,761,614 N155D probably benign Het
Rpl36-ps3 C A 12: 12,912,031 noncoding transcript Het
Rrp15 C A 1: 186,736,268 V184F possibly damaging Het
Rslcan18 G T 13: 67,102,100 L24M possibly damaging Het
Sall1 A G 8: 89,032,483 I331T probably benign Het
Slamf7 A T 1: 171,641,038 N95K possibly damaging Het
Slc1a6 T C 10: 78,800,117 Y339H probably damaging Het
Slc39a8 A G 3: 135,826,685 N72D probably benign Het
Slf1 A G 13: 77,083,449 S604P probably damaging Het
Slfn4 C T 11: 83,188,993 T110M probably benign Het
Tnpo1 T C 13: 98,878,712 T116A probably damaging Het
Tor1b T C 2: 30,955,881 I190T probably damaging Het
Ttn C A 2: 76,969,794 E357* probably null Het
Tubg2 G T 11: 101,156,873 E95* probably null Het
Ubap2 A G 4: 41,209,351 probably null Het
Ube2i T C 17: 25,268,564 D67G possibly damaging Het
Ubxn11 A G 4: 134,124,892 E50G probably damaging Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Zcchc7 A G 4: 44,929,124 T38A possibly damaging Het
Zfp236 A G 18: 82,646,005 S552P probably damaging Het
Other mutations in Olfr740
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Olfr740 APN 14 50453150 missense probably benign 0.04
IGL02117:Olfr740 APN 14 50453942 missense possibly damaging 0.91
IGL02663:Olfr740 APN 14 50453852 missense probably benign 0.02
IGL02858:Olfr740 APN 14 50453050 utr 5 prime probably benign
IGL02955:Olfr740 APN 14 50453985 missense probably damaging 0.99
IGL03210:Olfr740 APN 14 50453983 missense probably benign 0.10
IGL03249:Olfr740 APN 14 50453211 missense probably damaging 0.98
G1Funyon:Olfr740 UTSW 14 50453564 missense probably benign 0.08
R0946:Olfr740 UTSW 14 50453673 missense probably benign 0.13
R1465:Olfr740 UTSW 14 50453177 missense possibly damaging 0.91
R1465:Olfr740 UTSW 14 50453177 missense possibly damaging 0.91
R1513:Olfr740 UTSW 14 50453681 missense probably benign 0.00
R1908:Olfr740 UTSW 14 50453838 missense probably damaging 0.99
R2422:Olfr740 UTSW 14 50453436 missense probably damaging 1.00
R3406:Olfr740 UTSW 14 50453196 missense probably benign 0.14
R4184:Olfr740 UTSW 14 50453370 missense probably damaging 1.00
R4795:Olfr740 UTSW 14 50453417 missense probably damaging 0.96
R5028:Olfr740 UTSW 14 50453739 missense probably damaging 1.00
R5436:Olfr740 UTSW 14 50453727 missense probably damaging 1.00
R6057:Olfr740 UTSW 14 50453744 nonsense probably null
R6455:Olfr740 UTSW 14 50453585 missense possibly damaging 0.92
R6903:Olfr740 UTSW 14 50453955 missense possibly damaging 0.93
R6998:Olfr740 UTSW 14 50453433 missense probably benign 0.29
R7671:Olfr740 UTSW 14 50453885 missense probably benign 0.04
R8048:Olfr740 UTSW 14 50453916 missense possibly damaging 0.52
R8301:Olfr740 UTSW 14 50453564 missense probably benign 0.08
X0066:Olfr740 UTSW 14 50453658 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCTTTCTCCACTTGCGGATCTCAT -3'
(R):5'- CCTAGTCTCTGGGAAACATCCTATCCCT -3'

Sequencing Primer
(F):5'- GCGGATCTCATCTCACAGTAG -3'
(R):5'- gctcctgtcagtaagcacttc -3'
Posted On 2014-03-14