Incidental Mutation 'R1449:Ndrg2'
ID 159169
Institutional Source Beutler Lab
Gene Symbol Ndrg2
Ensembl Gene ENSMUSG00000004558
Gene Name N-myc downstream regulated gene 2
Synonyms Ndr2
MMRRC Submission 039504-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.579) question?
Stock # R1449 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 51905271-51914158 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 51908134 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 217 (Y217C)
Ref Sequence ENSEMBL: ENSMUSP00000154279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004673] [ENSMUST00000111632] [ENSMUST00000226184] [ENSMUST00000226528] [ENSMUST00000227237] [ENSMUST00000227402] [ENSMUST00000228164]
AlphaFold Q9QYG0
Predicted Effect probably damaging
Transcript: ENSMUST00000004673
AA Change: Y217C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004673
Gene: ENSMUSG00000004558
AA Change: Y217C

DomainStartEndE-ValueType
Pfam:Ndr 40 318 5.4e-125 PFAM
low complexity region 323 338 N/A INTRINSIC
low complexity region 342 355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111632
AA Change: Y203C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107259
Gene: ENSMUSG00000004558
AA Change: Y203C

DomainStartEndE-ValueType
Pfam:Ndr 26 304 4.7e-125 PFAM
Pfam:Abhydrolase_6 58 292 7.6e-11 PFAM
low complexity region 309 324 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226122
Predicted Effect probably benign
Transcript: ENSMUST00000226184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226366
Predicted Effect probably benign
Transcript: ENSMUST00000226528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226698
Predicted Effect probably damaging
Transcript: ENSMUST00000227237
AA Change: Y203C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227402
AA Change: Y217C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228620
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein that may play a role in neurite outgrowth. This gene may be involved in glioblastoma carcinogenesis. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele develop various types of tumors, including T-cell lymphomas, and have a shorter lifespan. Homozygotes for a second null allele show vertebral transformations. Homozygotes for a third null allele show reduced astrogliosis and inflammatory response after brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A G 4: 137,455,355 N274D possibly damaging Het
6430571L13Rik T A 9: 107,342,490 N47K probably damaging Het
Aasdh C T 5: 76,886,289 A472T probably benign Het
Abca13 A G 11: 9,298,580 T2776A probably damaging Het
Adamts10 T A 17: 33,545,639 V711D probably damaging Het
Adrb3 G A 8: 27,227,387 R345C probably damaging Het
Ak7 T C 12: 105,742,261 V325A possibly damaging Het
Armc6 G A 8: 70,225,293 L129F probably benign Het
Bend6 T C 1: 33,878,343 N10S probably benign Het
Bmpr1b T C 3: 141,871,373 E59G possibly damaging Het
Brd3 A G 2: 27,450,251 probably null Het
Brd3 A G 2: 27,457,016 Y369H probably damaging Het
Cacna1e C T 1: 154,485,662 probably null Het
Camk4 A G 18: 32,939,475 D27G probably damaging Het
Camkk1 T G 11: 73,033,884 S308A probably damaging Het
Catsperb A G 12: 101,588,197 T717A probably benign Het
Cdh23 A T 10: 60,376,951 S1563R probably damaging Het
Cep44 A T 8: 56,540,950 S197R probably benign Het
Col3a1 T A 1: 45,321,611 I67N unknown Het
Dcaf12l1 T C X: 44,789,427 T165A probably benign Het
Dicer1 T C 12: 104,729,243 Y143C possibly damaging Het
Dlg5 A G 14: 24,135,643 I1898T possibly damaging Het
Dnah1 T C 14: 31,263,951 N3762D probably damaging Het
Dscaml1 A T 9: 45,742,223 T1382S possibly damaging Het
Entpd3 A T 9: 120,566,489 R513W probably damaging Het
Foxred1 A G 9: 35,209,442 S132P probably damaging Het
Ftsj3 T C 11: 106,253,000 I273V probably benign Het
Hsd17b7 C T 1: 169,959,682 probably null Het
Iars T A 13: 49,733,710 V1253D probably damaging Het
Iqsec1 T A 6: 90,690,808 K216* probably null Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Kcnk2 G A 1: 189,340,026 S35L probably benign Het
Kif13a T C 13: 46,812,736 Y402C probably damaging Het
Lamc1 A G 1: 153,250,495 S484P probably benign Het
Lap3 T C 5: 45,509,519 probably null Het
Lhx8 G T 3: 154,328,105 S46* probably null Het
Lin7a T C 10: 107,323,952 S42P probably damaging Het
Lrba G A 3: 86,354,278 R1513Q probably damaging Het
Maml2 C A 9: 13,620,684 P398Q possibly damaging Het
Mast2 T C 4: 116,309,013 I1201V probably damaging Het
Mmp20 A T 9: 7,642,768 D201V probably damaging Het
Morn5 T A 2: 36,057,080 C123* probably null Het
Mrpl4 A G 9: 21,007,511 K175E possibly damaging Het
Nav3 A T 10: 109,853,511 S302T probably benign Het
Nfx1 A G 4: 40,976,803 D159G probably damaging Het
Nlrp9b A T 7: 20,023,164 T109S possibly damaging Het
Npepps A G 11: 97,207,154 Y909H probably benign Het
Olfr1510 A G 14: 52,410,567 C102R probably damaging Het
Olfr559 A T 7: 102,724,190 F100Y probably damaging Het
Olfr740 A G 14: 50,453,921 N290D probably damaging Het
Olfr801 T A 10: 129,670,369 D50V probably damaging Het
Olfr810 A C 10: 129,790,854 V245G probably damaging Het
Pcdh1 T C 18: 38,189,876 H968R probably damaging Het
Pde1b T A 15: 103,525,043 I296N probably damaging Het
Phldb1 T A 9: 44,716,633 T172S probably benign Het
Plxdc2 T C 2: 16,660,781 V215A possibly damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
Pou6f2 G T 13: 18,172,415 Q31K probably damaging Het
Psd T A 19: 46,324,811 Y40F probably damaging Het
Rnf126 T C 10: 79,761,614 N155D probably benign Het
Rpl36-ps3 C A 12: 12,912,031 noncoding transcript Het
Rrp15 C A 1: 186,736,268 V184F possibly damaging Het
Rslcan18 G T 13: 67,102,100 L24M possibly damaging Het
Sall1 A G 8: 89,032,483 I331T probably benign Het
Slamf7 A T 1: 171,641,038 N95K possibly damaging Het
Slc1a6 T C 10: 78,800,117 Y339H probably damaging Het
Slc39a8 A G 3: 135,826,685 N72D probably benign Het
Slf1 A G 13: 77,083,449 S604P probably damaging Het
Slfn4 C T 11: 83,188,993 T110M probably benign Het
Tnpo1 T C 13: 98,878,712 T116A probably damaging Het
Tor1b T C 2: 30,955,881 I190T probably damaging Het
Ttn C A 2: 76,969,794 E357* probably null Het
Tubg2 G T 11: 101,156,873 E95* probably null Het
Ubap2 A G 4: 41,209,351 probably null Het
Ube2i T C 17: 25,268,564 D67G possibly damaging Het
Ubxn11 A G 4: 134,124,892 E50G probably damaging Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Zcchc7 A G 4: 44,929,124 T38A possibly damaging Het
Zfp236 A G 18: 82,646,005 S552P probably damaging Het
Other mutations in Ndrg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02261:Ndrg2 APN 14 51911109 missense probably damaging 0.99
IGL02645:Ndrg2 APN 14 51906522 missense possibly damaging 0.87
IGL03226:Ndrg2 APN 14 51906569 unclassified probably benign
R0015:Ndrg2 UTSW 14 51910445 splice site probably benign
R0015:Ndrg2 UTSW 14 51910445 splice site probably benign
R0197:Ndrg2 UTSW 14 51907003 unclassified probably benign
R0606:Ndrg2 UTSW 14 51906217 missense probably damaging 1.00
R0812:Ndrg2 UTSW 14 51908662 splice site probably benign
R1625:Ndrg2 UTSW 14 51906963 missense probably damaging 1.00
R3803:Ndrg2 UTSW 14 51910675 splice site probably null
R5242:Ndrg2 UTSW 14 51911084 critical splice donor site probably null
R5424:Ndrg2 UTSW 14 51908885 missense probably damaging 0.97
R5568:Ndrg2 UTSW 14 51906963 missense probably damaging 1.00
R5703:Ndrg2 UTSW 14 51910122 critical splice acceptor site probably null
R6711:Ndrg2 UTSW 14 51910325 missense possibly damaging 0.94
R7515:Ndrg2 UTSW 14 51908923 missense probably benign 0.40
R7689:Ndrg2 UTSW 14 51910355 missense possibly damaging 0.53
R7934:Ndrg2 UTSW 14 51906204 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGCACACCACCTGTAATCACTTG -3'
(R):5'- ATCTGGACCTTCAGAGAGGGCATAG -3'

Sequencing Primer
(F):5'- GAATGAGAGCTGCCCTTACTC -3'
(R):5'- CGGACATGATTCTTGGACATC -3'
Posted On 2014-03-14