Mutagenetix > Incidental Mutations

Incidental Mutation 'R1463:Lamc3'

159198

Institutional Source

Beutler Lab

Gene Symbol

Lamc3

Ensembl Gene

ENSMUSG00000026840

Gene Name

laminin gamma 3

Synonyms

MMRRC Submission

039517-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1463 (G1)

Quality Score

168

Status

Validated

Chromosome

Chromosomal Location

31887291-31946539 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 31887411 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 23 (T23K)

Ref Sequence

ENSEMBL: ENSMUSP00000118745 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028187] [ENSMUST00000138325]

Predicted Effect

probably benign
Transcript: ENSMUST00000028187
AA Change: T23K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000028187
Gene: ENSMUSG00000026840
AA Change: T23K

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
LamNT	38	278	4.32e-115	SMART
EGF_Lam	280	333	4.19e-8	SMART
EGF_Lam	336	389	4.81e-8	SMART
EGF_Lam	392	436	2.52e-11	SMART
EGF_Lam	439	486	1.16e-10	SMART
low complexity region	538	549	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
EGF_like	649	716	3.69e0	SMART
EGF_Lam	719	764	3.1e-11	SMART
EGF_Lam	767	819	3.43e-4	SMART
EGF_Lam	822	875	2.16e-10	SMART
EGF_Lam	878	925	6.29e-12	SMART
EGF_Lam	928	973	1.62e-14	SMART
EGF_Lam	976	1021	1.02e-6	SMART
low complexity region	1032	1046	N/A	INTRINSIC
coiled coil region	1119	1150	N/A	INTRINSIC
low complexity region	1234	1247	N/A	INTRINSIC
low complexity region	1397	1407	N/A	INTRINSIC
coiled coil region	1444	1467	N/A	INTRINSIC
coiled coil region	1528	1575	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000138325
AA Change: T23K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000118745
Gene: ENSMUSG00000026840
AA Change: T23K

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
LamNT	38	278	4.32e-115	SMART
EGF_Lam	280	333	4.19e-8	SMART
EGF_Lam	336	389	4.81e-8	SMART
EGF_Lam	392	436	2.52e-11	SMART
EGF_Lam	439	486	1.16e-10	SMART
low complexity region	538	549	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
EGF_like	649	716	3.69e0	SMART
EGF_Lam	719	764	3.1e-11	SMART
EGF_Lam	767	819	3.43e-4	SMART
EGF_Lam	822	875	2.16e-10	SMART
EGF_Lam	878	925	6.29e-12	SMART
EGF_Lam	928	973	1.62e-14	SMART
EGF_Lam	976	1021	1.02e-6	SMART
low complexity region	1032	1046	N/A	INTRINSIC
coiled coil region	1119	1150	N/A	INTRINSIC
low complexity region	1245	1258	N/A	INTRINSIC
low complexity region	1408	1418	N/A	INTRINSIC
coiled coil region	1455	1478	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140104

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.6%

Validation Efficiency

97% (97/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 3. The gamma 3 chain is most similar to the gamma 1 chain, and contains all the 6 domains expected of the gamma chain. It is a component of laminin 12. The gamma 3 chain is broadly expressed in skin, heart, lung, and the reproductive tracts. In skin, it is seen within the basement membrane of the dermal-epidermal junction at points of nerve penetration. Gamma 3 is also a prominent element of the apical surface of ciliated epithelial cells of lung, oviduct, epididymis, ductus deferens, and seminiferous tubules. The distribution of gamma 3-containing laminins along ciliated epithelial surfaces suggests that the apical laminins are important in the morphogenesis and structural stability of the ciliated processes of these cells. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal amacrine cell morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	C	A	5: 5,452,073		probably benign	Het
4931408C20Rik	G	T	1: 26,682,141	Y1319*	probably null	Het
Abca5	A	T	11: 110,314,558	I299N	probably damaging	Het
Abcc8	T	C	7: 46,154,512	T413A	probably benign	Het
Actc1	G	A	2: 114,049,529	S201F	probably damaging	Het
Adam30	G	A	3: 98,162,525	C558Y	probably damaging	Het
Adcy4	T	A	14: 55,778,939	I352F	probably damaging	Het
Adgrl4	A	T	3: 151,510,596	D472V	probably damaging	Het
Afap1l2	T	A	19: 56,930,151	M117L	probably benign	Het
AI597479	T	C	1: 43,113,229	V229A	probably damaging	Het
Ascc1	T	C	10: 60,062,516	V267A	probably benign	Het
Asxl3	A	G	18: 22,516,753	S600G	possibly damaging	Het
Atg14	T	C	14: 47,548,994	I268V	probably benign	Het
Bcas1	C	T	2: 170,418,664	V32I	probably benign	Het
Cacna1c	G	T	6: 118,593,994	D2106E	probably benign	Het
Cacna1i	A	G	15: 80,379,054	H1440R	possibly damaging	Het
Catsper2	G	A	2: 121,406,446	T240M	probably damaging	Het
Cd163	A	G	6: 124,311,447	E279G	probably damaging	Het
Cdx2	C	T	5: 147,306,660	S108N	probably benign	Het
Cenpf	A	T	1: 189,654,739	N1781K	probably damaging	Het
Cgref1	T	A	5: 30,935,994		probably benign	Het
Clcn4	C	T	7: 7,296,764	W22*	probably null	Het
Cntn2	A	G	1: 132,521,137		probably null	Het
Cntn5	C	T	9: 9,673,796		probably null	Het
Cpeb3	A	G	19: 37,139,100	M377T	probably benign	Het
Cryge	T	A	1: 65,048,838	R135*	probably null	Het
Ctdsp2	C	A	10: 126,993,921		probably benign	Het
Ctsll3	G	A	13: 60,801,275		probably benign	Het
Cuzd1	C	A	7: 131,316,642	G189C	probably damaging	Het
Dmbt1	T	A	7: 131,109,637		probably null	Het
Dnajc13	A	T	9: 104,178,940	S1587R	probably damaging	Het
Dock4	GCTCAGTGTATC	GC	12: 40,816,325		probably null	Het
Dock6	T	C	9: 21,831,906	H701R	probably damaging	Het
Edem3	A	G	1: 151,807,510	T646A	possibly damaging	Het
Esrra	A	C	19: 6,912,455	D160E	probably benign	Het
Fbn2	T	C	18: 58,010,380	T2868A	probably benign	Het
Galnt7	T	A	8: 57,652,858	M41L	probably benign	Het
Gbf1	T	C	19: 46,271,545		probably benign	Het
Glyat	A	G	19: 12,648,103	N63S	probably damaging	Het
Gm9376	A	T	14: 118,267,482	M109L	probably benign	Het
H2-M10.3	A	G	17: 36,366,720	V222A	probably damaging	Het
Ifna12	T	G	4: 88,602,956	D118A	possibly damaging	Het
Inpp5j	T	C	11: 3,501,147	M501V	probably benign	Het
Itpr3	C	T	17: 27,117,154		probably benign	Het
Ivns1abp	A	G	1: 151,361,540	N527S	probably benign	Het
Kif13a	T	C	13: 46,929,612	T4A	possibly damaging	Het
Kif3b	T	C	2: 153,330,153	*748Q	probably null	Het
Klf8	C	T	X: 153,384,681	Q241*	probably null	Het
Kras	A	T	6: 145,225,061		probably benign	Het
Lrrc74b	T	A	16: 17,559,873	H47L	probably benign	Het
Ly75	A	G	2: 60,368,757		probably null	Het
Map3k21	G	A	8: 125,942,137	G821S	probably benign	Het
Mettl14	A	G	3: 123,374,073		probably benign	Het
Mettl5	T	C	2: 69,885,246		probably benign	Het
Mier3	A	G	13: 111,711,755	D301G	probably damaging	Het
Mipep	T	C	14: 60,788,146		probably benign	Het
Mmp21	T	C	7: 133,675,859		probably null	Het
Msh4	A	G	3: 153,857,570	L723P	probably damaging	Het
Muc5b	T	C	7: 141,859,080	V1921A	unknown	Het
Myo1e	G	A	9: 70,338,756	E410K	possibly damaging	Het
Nav2	T	G	7: 49,535,962	I951S	probably damaging	Het
Npc1	G	A	18: 12,191,830	T1202I	probably damaging	Het
Olfr1441	C	T	19: 12,422,888	T193I	probably benign	Het
Olfr218	A	G	1: 173,203,367	K4E	probably benign	Het
Olfr324	A	G	11: 58,598,121	R242G	probably damaging	Het
Patl2	C	T	2: 122,123,735	V452M	probably benign	Het
Pcdh18	A	G	3: 49,755,405	V487A	probably damaging	Het
Pdzph1	C	T	17: 58,932,445	A963T	probably damaging	Het
Pkd1l1	C	T	11: 8,916,302	V518M	probably damaging	Het
Plcd3	A	G	11: 103,078,373	F256S	probably damaging	Het
Proc	T	C	18: 32,133,438	D112G	possibly damaging	Het
Ptges2	T	A	2: 32,400,862		probably null	Het
Pth2r	A	T	1: 65,363,277	R312W	probably damaging	Het
Rbbp6	C	T	7: 122,992,453	H546Y	possibly damaging	Het
Retreg2	A	G	1: 75,146,520	E364G	probably damaging	Het
Rxrb	G	A	17: 34,034,160	C185Y	probably damaging	Het
Sept2	T	A	1: 93,499,315	N133K	possibly damaging	Het
Serpina3b	T	A	12: 104,138,710	S382T	probably benign	Het
Serpinb9e	T	C	13: 33,255,116	F175S	probably benign	Het
Slc19a2	C	T	1: 164,257,197	H219Y	probably damaging	Het
Slfn9	A	T	11: 82,981,698	D737E	possibly damaging	Het
Snx31	T	C	15: 36,539,298	E144G	probably null	Het
Sp2	A	G	11: 96,963,456		probably benign	Het
Spag9	C	T	11: 94,116,837	L1117F	probably damaging	Het
Syndig1l	A	T	12: 84,680,363		probably benign	Het
Sypl	A	T	12: 32,974,333		probably benign	Het
Tmem169	T	C	1: 72,300,696	M95T	probably benign	Het
Tmem206	T	C	1: 191,328,289		probably benign	Het
Tnfrsf17	A	G	16: 11,315,202	Y48C	possibly damaging	Het
Ttn	A	T	2: 76,827,515		probably benign	Het
Uap1	G	C	1: 170,150,383	H366Q	probably benign	Het
Ulbp1	A	G	10: 7,446,557		probably benign	Het
Urb2	T	C	8: 124,030,908	V1118A	probably benign	Het
Usp54	T	C	14: 20,550,190	N1493S	probably benign	Het
Vmn1r129	C	A	7: 21,360,730	V188F	probably benign	Het
Vmn1r226	A	T	17: 20,687,732	L75F	probably benign	Het
Wdr78	T	A	4: 103,087,418	L245F	possibly damaging	Het
Wisp1	T	A	15: 66,919,271	N307K	possibly damaging	Het
Yes1	T	A	5: 32,651,702	S137R	probably benign	Het
Zfp804b	A	G	5: 7,179,372		probably benign	Het

Other mutations in Lamc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Lamc3	APN	2	31900581	missense	probably damaging	0.99
IGL00823:Lamc3	APN	2	31918521	missense	probably damaging	1.00
IGL01020:Lamc3	APN	2	31914656	missense	probably benign	0.07
IGL01086:Lamc3	APN	2	31898476	missense	probably damaging	1.00
IGL01618:Lamc3	APN	2	31912107	missense	probably damaging	0.99
IGL01655:Lamc3	APN	2	31898278	missense	probably damaging	1.00
IGL02093:Lamc3	APN	2	31887655	missense	probably damaging	1.00
IGL02309:Lamc3	APN	2	31914604	splice site	probably benign
IGL02340:Lamc3	APN	2	31918457	missense	probably damaging	1.00
IGL02410:Lamc3	APN	2	31905965	missense	probably damaging	0.99
IGL02548:Lamc3	APN	2	31920662	missense	probably benign	0.00
IGL02679:Lamc3	APN	2	31945398	missense	probably benign	0.01
IGL02751:Lamc3	APN	2	31920704	missense	probably benign	0.07
IGL02820:Lamc3	APN	2	31923022	missense	probably damaging	1.00
IGL02926:Lamc3	APN	2	31935725	splice site	probably benign
IGL02926:Lamc3	APN	2	31935726	splice site	probably benign
IGL03090:Lamc3	APN	2	31908698	splice site	probably benign
IGL03258:Lamc3	APN	2	31887683	missense	probably damaging	1.00
R0005:Lamc3	UTSW	2	31922428	missense	probably benign	0.07
R0137:Lamc3	UTSW	2	31908616	missense	probably damaging	1.00
R0179:Lamc3	UTSW	2	31915084	splice site	probably benign
R0244:Lamc3	UTSW	2	31940721	missense	probably damaging	1.00
R0512:Lamc3	UTSW	2	31937968	missense	probably damaging	1.00
R1052:Lamc3	UTSW	2	31928802	missense	probably benign	0.03
R1142:Lamc3	UTSW	2	31940721	missense	probably damaging	1.00
R1366:Lamc3	UTSW	2	31928847	missense	probably damaging	1.00
R1515:Lamc3	UTSW	2	31940751	missense	probably damaging	1.00
R1642:Lamc3	UTSW	2	31915996	missense	probably damaging	1.00
R1692:Lamc3	UTSW	2	31921781	missense	probably null	0.01
R1707:Lamc3	UTSW	2	31912129	critical splice donor site	probably null
R1714:Lamc3	UTSW	2	31940757	missense	probably benign	0.02
R1838:Lamc3	UTSW	2	31925582	missense	possibly damaging	0.89
R2940:Lamc3	UTSW	2	31940702	missense	probably benign	0.02
R3177:Lamc3	UTSW	2	31908625	missense	probably damaging	1.00
R3277:Lamc3	UTSW	2	31908625	missense	probably damaging	1.00
R3846:Lamc3	UTSW	2	31924592	missense	probably benign	0.01
R4065:Lamc3	UTSW	2	31945258	missense	probably benign	0.00
R4089:Lamc3	UTSW	2	31920508	nonsense	probably null
R4373:Lamc3	UTSW	2	31898232	missense	probably damaging	1.00
R4394:Lamc3	UTSW	2	31931952	missense	probably benign
R4395:Lamc3	UTSW	2	31931952	missense	probably benign
R4397:Lamc3	UTSW	2	31931952	missense	probably benign
R4746:Lamc3	UTSW	2	31905614	missense	possibly damaging	0.77
R4948:Lamc3	UTSW	2	31940736	missense	probably benign	0.02
R4960:Lamc3	UTSW	2	31915954	missense	probably benign	0.00
R5025:Lamc3	UTSW	2	31908669	missense	probably benign	0.13
R5062:Lamc3	UTSW	2	31905667	missense	possibly damaging	0.60
R5170:Lamc3	UTSW	2	31887344	start codon destroyed	probably benign	0.03
R5286:Lamc3	UTSW	2	31918596	missense	probably damaging	1.00
R5457:Lamc3	UTSW	2	31931985	missense	probably benign
R5655:Lamc3	UTSW	2	31925717	missense	probably benign	0.01
R5928:Lamc3	UTSW	2	31921709	missense	probably benign	0.00
R6018:Lamc3	UTSW	2	31905712	missense	probably damaging	1.00
R6479:Lamc3	UTSW	2	31887401	missense	probably benign
R6601:Lamc3	UTSW	2	31920532	missense	possibly damaging	0.94
R6920:Lamc3	UTSW	2	31908689	missense	probably damaging	1.00
R6924:Lamc3	UTSW	2	31938069	missense	probably benign
R7114:Lamc3	UTSW	2	31930645	missense	probably damaging	0.99
R7305:Lamc3	UTSW	2	31930702	missense	probably benign	0.39
R7559:Lamc3	UTSW	2	31922368	missense	probably benign	0.00
R7787:Lamc3	UTSW	2	31900539	missense	probably damaging	0.99
R7819:Lamc3	UTSW	2	31921763	missense	probably benign
X0010:Lamc3	UTSW	2	31938012	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCATAGAAGAGCCGCATTAGCAG -3'
(R):5'- TCAGGTTAACAGAGGTGGGGTACTG -3'

Sequencing Primer
(F):5'- GCCGCATTAGCAGAATAACTTG -3'
(R):5'- ATGGATGGGCTCTGCCAC -3'

Posted On

2014-03-14