Incidental Mutation 'R1463:Abca5'
ID159246
Institutional Source Beutler Lab
Gene Symbol Abca5
Ensembl Gene ENSMUSG00000018800
Gene NameATP-binding cassette, sub-family A (ABC1), member 5
SynonymsABC13, B930033A02Rik
MMRRC Submission 039517-MU
Accession Numbers

NCBI RefSeq: NM_147219.2; MGI: 2386607

Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R1463 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location110269369-110337716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110314558 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 299 (I299N)
Ref Sequence ENSEMBL: ENSMUSP00000120708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043961] [ENSMUST00000124714]
Predicted Effect probably damaging
Transcript: ENSMUST00000043961
AA Change: I299N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047927
Gene: ENSMUSG00000018800
AA Change: I299N

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 29 416 4.3e-33 PFAM
AAA 506 691 2.88e-8 SMART
low complexity region 733 744 N/A INTRINSIC
transmembrane domain 864 886 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
low complexity region 1262 1267 N/A INTRINSIC
AAA 1325 1512 3.52e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124714
AA Change: I299N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120708
Gene: ENSMUSG00000018800
AA Change: I299N

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 30 416 9.5e-32 PFAM
AAA 506 691 2.88e-8 SMART
low complexity region 733 744 N/A INTRINSIC
transmembrane domain 864 886 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
transmembrane domain 1019 1041 N/A INTRINSIC
transmembrane domain 1074 1096 N/A INTRINSIC
transmembrane domain 1103 1125 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
transmembrane domain 1165 1187 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127318
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 97% (97/100)
MGI Phenotype Strain: 3581814
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24, but neither the substrate nor the function of this gene is known. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exophthalmos, tremors and collapse of the thyroid gland, and develop a dilated cardiomyopathy with large thrombi due to depression of the cardiac function. Severe edema, liver injury and premature death appear to be sensitive to genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,073 probably benign Het
4931408C20Rik G T 1: 26,682,141 Y1319* probably null Het
Abcc8 T C 7: 46,154,512 T413A probably benign Het
Actc1 G A 2: 114,049,529 S201F probably damaging Het
Adam30 G A 3: 98,162,525 C558Y probably damaging Het
Adcy4 T A 14: 55,778,939 I352F probably damaging Het
Adgrl4 A T 3: 151,510,596 D472V probably damaging Het
Afap1l2 T A 19: 56,930,151 M117L probably benign Het
AI597479 T C 1: 43,113,229 V229A probably damaging Het
Ascc1 T C 10: 60,062,516 V267A probably benign Het
Asxl3 A G 18: 22,516,753 S600G possibly damaging Het
Atg14 T C 14: 47,548,994 I268V probably benign Het
Bcas1 C T 2: 170,418,664 V32I probably benign Het
Cacna1c G T 6: 118,593,994 D2106E probably benign Het
Cacna1i A G 15: 80,379,054 H1440R possibly damaging Het
Catsper2 G A 2: 121,406,446 T240M probably damaging Het
Cd163 A G 6: 124,311,447 E279G probably damaging Het
Cdx2 C T 5: 147,306,660 S108N probably benign Het
Cenpf A T 1: 189,654,739 N1781K probably damaging Het
Cgref1 T A 5: 30,935,994 probably benign Het
Clcn4 C T 7: 7,296,764 W22* probably null Het
Cntn2 A G 1: 132,521,137 probably null Het
Cntn5 C T 9: 9,673,796 probably null Het
Cpeb3 A G 19: 37,139,100 M377T probably benign Het
Cryge T A 1: 65,048,838 R135* probably null Het
Ctdsp2 C A 10: 126,993,921 probably benign Het
Ctsll3 G A 13: 60,801,275 probably benign Het
Cuzd1 C A 7: 131,316,642 G189C probably damaging Het
Dmbt1 T A 7: 131,109,637 probably null Het
Dnajc13 A T 9: 104,178,940 S1587R probably damaging Het
Dock4 GCTCAGTGTATC GC 12: 40,816,325 probably null Het
Dock6 T C 9: 21,831,906 H701R probably damaging Het
Edem3 A G 1: 151,807,510 T646A possibly damaging Het
Esrra A C 19: 6,912,455 D160E probably benign Het
Fbn2 T C 18: 58,010,380 T2868A probably benign Het
Galnt7 T A 8: 57,652,858 M41L probably benign Het
Gbf1 T C 19: 46,271,545 probably benign Het
Glyat A G 19: 12,648,103 N63S probably damaging Het
Gm9376 A T 14: 118,267,482 M109L probably benign Het
H2-M10.3 A G 17: 36,366,720 V222A probably damaging Het
Ifna12 T G 4: 88,602,956 D118A possibly damaging Het
Inpp5j T C 11: 3,501,147 M501V probably benign Het
Itpr3 C T 17: 27,117,154 probably benign Het
Ivns1abp A G 1: 151,361,540 N527S probably benign Het
Kif13a T C 13: 46,929,612 T4A possibly damaging Het
Kif3b T C 2: 153,330,153 *748Q probably null Het
Klf8 C T X: 153,384,681 Q241* probably null Het
Kras A T 6: 145,225,061 probably benign Het
Lamc3 C A 2: 31,887,411 T23K probably benign Het
Lrrc74b T A 16: 17,559,873 H47L probably benign Het
Ly75 A G 2: 60,368,757 probably null Het
Map3k21 G A 8: 125,942,137 G821S probably benign Het
Mettl14 A G 3: 123,374,073 probably benign Het
Mettl5 T C 2: 69,885,246 probably benign Het
Mier3 A G 13: 111,711,755 D301G probably damaging Het
Mipep T C 14: 60,788,146 probably benign Het
Mmp21 T C 7: 133,675,859 probably null Het
Msh4 A G 3: 153,857,570 L723P probably damaging Het
Muc5b T C 7: 141,859,080 V1921A unknown Het
Myo1e G A 9: 70,338,756 E410K possibly damaging Het
Nav2 T G 7: 49,535,962 I951S probably damaging Het
Npc1 G A 18: 12,191,830 T1202I probably damaging Het
Olfr1441 C T 19: 12,422,888 T193I probably benign Het
Olfr218 A G 1: 173,203,367 K4E probably benign Het
Olfr324 A G 11: 58,598,121 R242G probably damaging Het
Patl2 C T 2: 122,123,735 V452M probably benign Het
Pcdh18 A G 3: 49,755,405 V487A probably damaging Het
Pdzph1 C T 17: 58,932,445 A963T probably damaging Het
Pkd1l1 C T 11: 8,916,302 V518M probably damaging Het
Plcd3 A G 11: 103,078,373 F256S probably damaging Het
Proc T C 18: 32,133,438 D112G possibly damaging Het
Ptges2 T A 2: 32,400,862 probably null Het
Pth2r A T 1: 65,363,277 R312W probably damaging Het
Rbbp6 C T 7: 122,992,453 H546Y possibly damaging Het
Retreg2 A G 1: 75,146,520 E364G probably damaging Het
Rxrb G A 17: 34,034,160 C185Y probably damaging Het
Sept2 T A 1: 93,499,315 N133K possibly damaging Het
Serpina3b T A 12: 104,138,710 S382T probably benign Het
Serpinb9e T C 13: 33,255,116 F175S probably benign Het
Slc19a2 C T 1: 164,257,197 H219Y probably damaging Het
Slfn9 A T 11: 82,981,698 D737E possibly damaging Het
Snx31 T C 15: 36,539,298 E144G probably null Het
Sp2 A G 11: 96,963,456 probably benign Het
Spag9 C T 11: 94,116,837 L1117F probably damaging Het
Syndig1l A T 12: 84,680,363 probably benign Het
Sypl A T 12: 32,974,333 probably benign Het
Tmem169 T C 1: 72,300,696 M95T probably benign Het
Tmem206 T C 1: 191,328,289 probably benign Het
Tnfrsf17 A G 16: 11,315,202 Y48C possibly damaging Het
Ttn A T 2: 76,827,515 probably benign Het
Uap1 G C 1: 170,150,383 H366Q probably benign Het
Ulbp1 A G 10: 7,446,557 probably benign Het
Urb2 T C 8: 124,030,908 V1118A probably benign Het
Usp54 T C 14: 20,550,190 N1493S probably benign Het
Vmn1r129 C A 7: 21,360,730 V188F probably benign Het
Vmn1r226 A T 17: 20,687,732 L75F probably benign Het
Wdr78 T A 4: 103,087,418 L245F possibly damaging Het
Wisp1 T A 15: 66,919,271 N307K possibly damaging Het
Yes1 T A 5: 32,651,702 S137R probably benign Het
Zfp804b A G 5: 7,179,372 probably benign Het
Other mutations in Abca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Abca5 APN 11 110309450 critical splice acceptor site probably null
IGL00675:Abca5 APN 11 110304985 missense probably damaging 1.00
IGL01512:Abca5 APN 11 110317823 missense probably benign 0.40
IGL01559:Abca5 APN 11 110272526 missense probably benign
IGL01584:Abca5 APN 11 110304923 missense probably damaging 0.98
IGL01604:Abca5 APN 11 110277636 missense possibly damaging 0.47
IGL01828:Abca5 APN 11 110287695 missense probably benign
IGL01880:Abca5 APN 11 110293263 missense probably benign 0.01
IGL02054:Abca5 APN 11 110292123 missense probably damaging 0.99
IGL02074:Abca5 APN 11 110293350 missense probably benign 0.00
IGL02233:Abca5 APN 11 110274344 nonsense probably null
IGL02245:Abca5 APN 11 110298169 nonsense probably null
IGL02317:Abca5 APN 11 110327761 missense probably benign 0.09
IGL02352:Abca5 APN 11 110275330 missense probably benign 0.01
IGL02359:Abca5 APN 11 110275330 missense probably benign 0.01
IGL02390:Abca5 APN 11 110296551 missense probably benign
IGL02600:Abca5 APN 11 110309438 missense probably benign 0.02
IGL02639:Abca5 APN 11 110288073 missense possibly damaging 0.79
IGL03000:Abca5 APN 11 110317814 missense probably benign 0.04
IGL03074:Abca5 APN 11 110310275 missense probably benign 0.01
IGL03078:Abca5 APN 11 110276545 nonsense probably null
IGL03342:Abca5 APN 11 110287691 missense possibly damaging 0.94
IGL03368:Abca5 APN 11 110313522 splice site probably benign
Atles UTSW 11 110299929 missense probably damaging 0.99
Demento UTSW 11 110310233 missense probably damaging 1.00
jones UTSW 11 110288058 splice site probably null
R0106:Abca5 UTSW 11 110319825 missense probably damaging 1.00
R0116:Abca5 UTSW 11 110276505 missense probably damaging 1.00
R0305:Abca5 UTSW 11 110273311 splice site probably benign
R0550:Abca5 UTSW 11 110293840 missense probably damaging 1.00
R0578:Abca5 UTSW 11 110276489 nonsense probably null
R0587:Abca5 UTSW 11 110311377 missense probably benign 0.00
R0610:Abca5 UTSW 11 110301527 missense probably benign 0.00
R0617:Abca5 UTSW 11 110279689 missense probably damaging 0.98
R0667:Abca5 UTSW 11 110327811 missense probably benign 0.00
R0844:Abca5 UTSW 11 110319832 missense probably benign 0.00
R1273:Abca5 UTSW 11 110326665 missense probably benign 0.01
R1511:Abca5 UTSW 11 110299978 missense probably damaging 1.00
R1511:Abca5 UTSW 11 110299986 missense possibly damaging 0.73
R1687:Abca5 UTSW 11 110293888 missense probably benign 0.32
R1759:Abca5 UTSW 11 110293848 missense probably benign
R1870:Abca5 UTSW 11 110329217 missense probably benign 0.33
R2006:Abca5 UTSW 11 110313449 missense probably benign
R2039:Abca5 UTSW 11 110299929 missense probably damaging 0.99
R2076:Abca5 UTSW 11 110287652 missense probably benign 0.10
R2136:Abca5 UTSW 11 110319832 missense probably benign 0.00
R2154:Abca5 UTSW 11 110292174 missense probably benign 0.00
R2273:Abca5 UTSW 11 110275281 missense possibly damaging 0.93
R2274:Abca5 UTSW 11 110275281 missense possibly damaging 0.93
R2275:Abca5 UTSW 11 110275281 missense possibly damaging 0.93
R2328:Abca5 UTSW 11 110276521 missense probably damaging 0.99
R3702:Abca5 UTSW 11 110288058 splice site probably null
R3768:Abca5 UTSW 11 110313391 missense probably benign 0.01
R3872:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R3873:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R3874:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R3875:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R4347:Abca5 UTSW 11 110299968 missense probably damaging 1.00
R4429:Abca5 UTSW 11 110311410 missense probably benign 0.00
R4790:Abca5 UTSW 11 110311410 missense possibly damaging 0.63
R4812:Abca5 UTSW 11 110301821 missense probably damaging 1.00
R4833:Abca5 UTSW 11 110279316 missense probably benign 0.00
R4883:Abca5 UTSW 11 110326631 missense probably damaging 1.00
R5000:Abca5 UTSW 11 110310224 missense probably damaging 1.00
R5004:Abca5 UTSW 11 110279376 missense probably damaging 0.99
R5066:Abca5 UTSW 11 110309350 intron probably benign
R5230:Abca5 UTSW 11 110319860 missense probably benign
R5321:Abca5 UTSW 11 110327825 missense probably benign
R5350:Abca5 UTSW 11 110319796 nonsense probably null
R5414:Abca5 UTSW 11 110314622 missense probably damaging 1.00
R5437:Abca5 UTSW 11 110319796 nonsense probably null
R5451:Abca5 UTSW 11 110319796 nonsense probably null
R5453:Abca5 UTSW 11 110319796 nonsense probably null
R5488:Abca5 UTSW 11 110292183 missense probably benign 0.00
R5636:Abca5 UTSW 11 110301536 missense probably benign 0.00
R5805:Abca5 UTSW 11 110279390 missense probably benign 0.06
R5900:Abca5 UTSW 11 110279156 missense possibly damaging 0.92
R6152:Abca5 UTSW 11 110313361 missense probably damaging 1.00
R6167:Abca5 UTSW 11 110292105 missense probably benign 0.10
R6343:Abca5 UTSW 11 110314552 missense probably damaging 1.00
R6425:Abca5 UTSW 11 110329232 missense possibly damaging 0.75
R6493:Abca5 UTSW 11 110293878 missense probably benign 0.00
R6498:Abca5 UTSW 11 110292102 missense possibly damaging 0.70
R6884:Abca5 UTSW 11 110329217 missense probably damaging 0.96
R6912:Abca5 UTSW 11 110306280 missense probably benign 0.35
R7084:Abca5 UTSW 11 110301545 missense probably benign 0.22
R7239:Abca5 UTSW 11 110326704 missense possibly damaging 0.94
R7490:Abca5 UTSW 11 110277611 missense possibly damaging 0.95
R7527:Abca5 UTSW 11 110327730 critical splice donor site probably null
R7702:Abca5 UTSW 11 110276452 critical splice donor site probably null
R7763:Abca5 UTSW 11 110272497 missense possibly damaging 0.85
R8237:Abca5 UTSW 11 110310155 missense probably benign 0.01
RF014:Abca5 UTSW 11 110279754 critical splice acceptor site probably null
Z1177:Abca5 UTSW 11 110279328 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAGTGTGCAACCTTTCACAGGAC -3'
(R):5'- TTGGGTGCATGAACACACGCAG -3'

Sequencing Primer
(F):5'- GTGCAACCTTTCACAGGACAAATAG -3'
(R):5'- GCATGAACACACGCAGATAAATTG -3'
Posted On2014-03-14