Incidental Mutation 'R1463:Usp54'
ID 159255
Institutional Source Beutler Lab
Gene Symbol Usp54
Ensembl Gene ENSMUSG00000034235
Gene Name ubiquitin specific peptidase 54
Synonyms 4930429G18Rik, C030002J06Rik
MMRRC Submission 039517-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1463 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 20598980-20691131 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20600258 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1493 (N1493S)
Ref Sequence ENSEMBL: ENSMUSP00000036214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022355] [ENSMUST00000022356] [ENSMUST00000035340] [ENSMUST00000159027] [ENSMUST00000161445] [ENSMUST00000161989]
AlphaFold Q8BL06
Predicted Effect probably benign
Transcript: ENSMUST00000022355
SMART Domains Protein: ENSMUSP00000022355
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022356
AA Change: N1493S

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022356
Gene: ENSMUSG00000034235
AA Change: N1493S

DomainStartEndE-ValueType
Pfam:UCH 30 349 2.4e-23 PFAM
Pfam:UCH_1 31 324 2.1e-7 PFAM
low complexity region 403 412 N/A INTRINSIC
low complexity region 439 445 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
coiled coil region 682 712 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 881 894 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035340
AA Change: N1493S

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000036214
Gene: ENSMUSG00000034235
AA Change: N1493S

DomainStartEndE-ValueType
Pfam:UCH 31 349 2.3e-21 PFAM
low complexity region 403 412 N/A INTRINSIC
low complexity region 439 445 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
coiled coil region 682 712 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 881 894 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142099
Predicted Effect probably benign
Transcript: ENSMUST00000159027
SMART Domains Protein: ENSMUSP00000125722
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161445
SMART Domains Protein: ENSMUSP00000125630
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161989
SMART Domains Protein: ENSMUSP00000125582
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
low complexity region 487 497 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 97% (97/100)
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,205,384 (GRCm39) I299N probably damaging Het
Abcc8 T C 7: 45,803,936 (GRCm39) T413A probably benign Het
Actc1 G A 2: 113,880,010 (GRCm39) S201F probably damaging Het
Adam30 G A 3: 98,069,841 (GRCm39) C558Y probably damaging Het
Adcy4 T A 14: 56,016,396 (GRCm39) I352F probably damaging Het
Adgrl4 A T 3: 151,216,233 (GRCm39) D472V probably damaging Het
Afap1l2 T A 19: 56,918,583 (GRCm39) M117L probably benign Het
AI597479 T C 1: 43,152,389 (GRCm39) V229A probably damaging Het
Ascc1 T C 10: 59,898,338 (GRCm39) V267A probably benign Het
Asxl3 A G 18: 22,649,810 (GRCm39) S600G possibly damaging Het
Atg14 T C 14: 47,786,451 (GRCm39) I268V probably benign Het
Bcas1 C T 2: 170,260,584 (GRCm39) V32I probably benign Het
Cacna1c G T 6: 118,570,955 (GRCm39) D2106E probably benign Het
Cacna1i A G 15: 80,263,255 (GRCm39) H1440R possibly damaging Het
Catsper2 G A 2: 121,236,927 (GRCm39) T240M probably damaging Het
Ccn4 T A 15: 66,791,120 (GRCm39) N307K possibly damaging Het
Cd163 A G 6: 124,288,406 (GRCm39) E279G probably damaging Het
Cdx2 C T 5: 147,243,470 (GRCm39) S108N probably benign Het
Cenpf A T 1: 189,386,936 (GRCm39) N1781K probably damaging Het
Cgref1 T A 5: 31,093,338 (GRCm39) probably benign Het
Clcn4 C T 7: 7,299,763 (GRCm39) W22* probably null Het
Cntn2 A G 1: 132,448,875 (GRCm39) probably null Het
Cntn5 C T 9: 9,673,801 (GRCm39) probably null Het
Cpeb3 A G 19: 37,116,500 (GRCm39) M377T probably benign Het
Cryge T A 1: 65,087,997 (GRCm39) R135* probably null Het
Ctdsp2 C A 10: 126,829,790 (GRCm39) probably benign Het
Ctsll3 G A 13: 60,949,089 (GRCm39) probably benign Het
Cuzd1 C A 7: 130,918,371 (GRCm39) G189C probably damaging Het
Dmbt1 T A 7: 130,711,366 (GRCm39) probably null Het
Dnai4 T A 4: 102,944,615 (GRCm39) L245F possibly damaging Het
Dnajc13 A T 9: 104,056,139 (GRCm39) S1587R probably damaging Het
Dock4 GCTCAGTGTATC GC 12: 40,866,324 (GRCm39) probably null Het
Dock6 T C 9: 21,743,202 (GRCm39) H701R probably damaging Het
Edem3 A G 1: 151,683,261 (GRCm39) T646A possibly damaging Het
Esrra A C 19: 6,889,823 (GRCm39) D160E probably benign Het
Fbn2 T C 18: 58,143,452 (GRCm39) T2868A probably benign Het
Galnt7 T A 8: 58,105,892 (GRCm39) M41L probably benign Het
Gbf1 T C 19: 46,259,984 (GRCm39) probably benign Het
Glyat A G 19: 12,625,467 (GRCm39) N63S probably damaging Het
Gm9376 A T 14: 118,504,894 (GRCm39) M109L probably benign Het
H2-M10.3 A G 17: 36,677,612 (GRCm39) V222A probably damaging Het
Ifna12 T G 4: 88,521,193 (GRCm39) D118A possibly damaging Het
Inpp5j T C 11: 3,451,147 (GRCm39) M501V probably benign Het
Itpr3 C T 17: 27,336,128 (GRCm39) probably benign Het
Ivns1abp A G 1: 151,237,291 (GRCm39) N527S probably benign Het
Kif13a T C 13: 47,083,088 (GRCm39) T4A possibly damaging Het
Kif3b T C 2: 153,172,073 (GRCm39) *748Q probably null Het
Klf8 C T X: 152,167,677 (GRCm39) Q241* probably null Het
Kras A T 6: 145,170,787 (GRCm39) probably benign Het
Lamc3 C A 2: 31,777,423 (GRCm39) T23K probably benign Het
Lrrc74b T A 16: 17,377,737 (GRCm39) H47L probably benign Het
Ly75 A G 2: 60,199,101 (GRCm39) probably null Het
Map3k21 G A 8: 126,668,876 (GRCm39) G821S probably benign Het
Mettl14 A G 3: 123,167,722 (GRCm39) probably benign Het
Mettl5 T C 2: 69,715,590 (GRCm39) probably benign Het
Mier3 A G 13: 111,848,289 (GRCm39) D301G probably damaging Het
Mipep T C 14: 61,025,595 (GRCm39) probably benign Het
Mmp21 T C 7: 133,277,588 (GRCm39) probably null Het
Msh4 A G 3: 153,563,207 (GRCm39) L723P probably damaging Het
Muc5b T C 7: 141,412,817 (GRCm39) V1921A unknown Het
Myo1e G A 9: 70,246,038 (GRCm39) E410K possibly damaging Het
Nav2 T G 7: 49,185,710 (GRCm39) I951S probably damaging Het
Npc1 G A 18: 12,324,887 (GRCm39) T1202I probably damaging Het
Or10j3 A G 1: 173,030,934 (GRCm39) K4E probably benign Het
Or2ab1 A G 11: 58,488,947 (GRCm39) R242G probably damaging Het
Or5a3 C T 19: 12,400,252 (GRCm39) T193I probably benign Het
Pacc1 T C 1: 191,060,486 (GRCm39) probably benign Het
Patl2 C T 2: 121,954,216 (GRCm39) V452M probably benign Het
Pcdh18 A G 3: 49,709,854 (GRCm39) V487A probably damaging Het
Pdzph1 C T 17: 59,239,440 (GRCm39) A963T probably damaging Het
Pkd1l1 C T 11: 8,866,302 (GRCm39) V518M probably damaging Het
Plcd3 A G 11: 102,969,199 (GRCm39) F256S probably damaging Het
Proc T C 18: 32,266,491 (GRCm39) D112G possibly damaging Het
Ptges2 T A 2: 32,290,874 (GRCm39) probably null Het
Pth2r A T 1: 65,402,436 (GRCm39) R312W probably damaging Het
Pttg1ip2 C A 5: 5,502,073 (GRCm39) probably benign Het
Rbbp6 C T 7: 122,591,676 (GRCm39) H546Y possibly damaging Het
Retreg2 A G 1: 75,123,164 (GRCm39) E364G probably damaging Het
Rxrb G A 17: 34,253,134 (GRCm39) C185Y probably damaging Het
Septin2 T A 1: 93,427,037 (GRCm39) N133K possibly damaging Het
Serpina3b T A 12: 104,104,969 (GRCm39) S382T probably benign Het
Serpinb9e T C 13: 33,439,099 (GRCm39) F175S probably benign Het
Slc19a2 C T 1: 164,084,766 (GRCm39) H219Y probably damaging Het
Slfn9 A T 11: 82,872,524 (GRCm39) D737E possibly damaging Het
Snx31 T C 15: 36,539,444 (GRCm39) E144G probably null Het
Sp2 A G 11: 96,854,282 (GRCm39) probably benign Het
Spag9 C T 11: 94,007,663 (GRCm39) L1117F probably damaging Het
Spata31e2 G T 1: 26,721,222 (GRCm39) Y1319* probably null Het
Syndig1l A T 12: 84,727,137 (GRCm39) probably benign Het
Sypl1 A T 12: 33,024,332 (GRCm39) probably benign Het
Tmem169 T C 1: 72,339,855 (GRCm39) M95T probably benign Het
Tnfrsf17 A G 16: 11,133,066 (GRCm39) Y48C possibly damaging Het
Ttn A T 2: 76,657,859 (GRCm39) probably benign Het
Uap1 G C 1: 169,977,952 (GRCm39) H366Q probably benign Het
Ulbp1 A G 10: 7,396,557 (GRCm39) probably benign Het
Urb2 T C 8: 124,757,647 (GRCm39) V1118A probably benign Het
Vmn1r129 C A 7: 21,094,655 (GRCm39) V188F probably benign Het
Vmn1r226 A T 17: 20,907,994 (GRCm39) L75F probably benign Het
Yes1 T A 5: 32,809,046 (GRCm39) S137R probably benign Het
Zfp804b A G 5: 7,229,372 (GRCm39) probably benign Het
Other mutations in Usp54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Usp54 APN 14 20,623,905 (GRCm39) missense probably damaging 1.00
IGL01090:Usp54 APN 14 20,636,225 (GRCm39) unclassified probably benign
IGL02030:Usp54 APN 14 20,616,014 (GRCm39) missense probably benign 0.44
IGL02333:Usp54 APN 14 20,639,463 (GRCm39) missense probably damaging 1.00
IGL02642:Usp54 APN 14 20,615,140 (GRCm39) splice site probably benign
IGL02970:Usp54 APN 14 20,627,540 (GRCm39) missense probably damaging 1.00
IGL03371:Usp54 APN 14 20,639,436 (GRCm39) unclassified probably benign
BB003:Usp54 UTSW 14 20,627,036 (GRCm39) missense probably damaging 1.00
BB013:Usp54 UTSW 14 20,627,036 (GRCm39) missense probably damaging 1.00
R0050:Usp54 UTSW 14 20,623,823 (GRCm39) unclassified probably benign
R0383:Usp54 UTSW 14 20,611,320 (GRCm39) missense probably benign 0.00
R0427:Usp54 UTSW 14 20,620,432 (GRCm39) missense probably benign
R0442:Usp54 UTSW 14 20,657,277 (GRCm39) missense probably damaging 1.00
R0574:Usp54 UTSW 14 20,606,322 (GRCm39) missense probably benign 0.00
R0638:Usp54 UTSW 14 20,639,437 (GRCm39) unclassified probably benign
R0789:Usp54 UTSW 14 20,612,225 (GRCm39) missense probably benign 0.01
R1272:Usp54 UTSW 14 20,611,178 (GRCm39) missense probably damaging 0.99
R1565:Usp54 UTSW 14 20,657,227 (GRCm39) missense probably damaging 1.00
R1721:Usp54 UTSW 14 20,633,508 (GRCm39) nonsense probably null
R1922:Usp54 UTSW 14 20,610,972 (GRCm39) missense probably benign 0.00
R2068:Usp54 UTSW 14 20,627,273 (GRCm39) missense probably damaging 1.00
R2216:Usp54 UTSW 14 20,611,908 (GRCm39) missense probably benign
R2285:Usp54 UTSW 14 20,611,246 (GRCm39) missense possibly damaging 0.52
R2426:Usp54 UTSW 14 20,615,008 (GRCm39) missense probably benign 0.00
R3855:Usp54 UTSW 14 20,638,488 (GRCm39) missense probably damaging 1.00
R3856:Usp54 UTSW 14 20,638,488 (GRCm39) missense probably damaging 1.00
R3907:Usp54 UTSW 14 20,636,181 (GRCm39) missense probably damaging 1.00
R4367:Usp54 UTSW 14 20,611,202 (GRCm39) missense probably benign 0.02
R4384:Usp54 UTSW 14 20,600,153 (GRCm39) splice site probably null
R4555:Usp54 UTSW 14 20,611,090 (GRCm39) missense probably benign 0.06
R4617:Usp54 UTSW 14 20,600,406 (GRCm39) missense probably benign 0.04
R4659:Usp54 UTSW 14 20,615,060 (GRCm39) missense probably damaging 1.00
R4672:Usp54 UTSW 14 20,631,597 (GRCm39) intron probably benign
R4928:Usp54 UTSW 14 20,612,260 (GRCm39) missense probably damaging 1.00
R5381:Usp54 UTSW 14 20,636,144 (GRCm39) missense probably damaging 1.00
R5408:Usp54 UTSW 14 20,600,501 (GRCm39) missense probably damaging 1.00
R5630:Usp54 UTSW 14 20,615,125 (GRCm39) missense probably damaging 1.00
R5841:Usp54 UTSW 14 20,600,351 (GRCm39) missense probably benign 0.04
R5886:Usp54 UTSW 14 20,611,910 (GRCm39) missense probably benign 0.28
R5922:Usp54 UTSW 14 20,602,139 (GRCm39) splice site probably null
R5975:Usp54 UTSW 14 20,633,419 (GRCm39) missense possibly damaging 0.77
R6074:Usp54 UTSW 14 20,602,167 (GRCm39) missense probably benign 0.02
R6183:Usp54 UTSW 14 20,602,313 (GRCm39) missense probably damaging 0.99
R6234:Usp54 UTSW 14 20,633,518 (GRCm39) missense probably damaging 1.00
R6303:Usp54 UTSW 14 20,611,036 (GRCm39) missense possibly damaging 0.95
R6304:Usp54 UTSW 14 20,611,036 (GRCm39) missense possibly damaging 0.95
R6695:Usp54 UTSW 14 20,610,937 (GRCm39) missense possibly damaging 0.94
R6774:Usp54 UTSW 14 20,627,296 (GRCm39) missense probably damaging 1.00
R6941:Usp54 UTSW 14 20,612,177 (GRCm39) missense probably benign
R7133:Usp54 UTSW 14 20,611,310 (GRCm39) missense probably benign 0.00
R7196:Usp54 UTSW 14 20,638,438 (GRCm39) missense probably damaging 1.00
R7409:Usp54 UTSW 14 20,602,313 (GRCm39) missense probably damaging 0.99
R7424:Usp54 UTSW 14 20,627,108 (GRCm39) missense probably benign 0.15
R7859:Usp54 UTSW 14 20,638,204 (GRCm39) missense probably benign 0.24
R7926:Usp54 UTSW 14 20,627,036 (GRCm39) missense probably damaging 1.00
R7954:Usp54 UTSW 14 20,611,981 (GRCm39) missense probably benign 0.01
R8489:Usp54 UTSW 14 20,611,604 (GRCm39) missense probably benign 0.31
R8745:Usp54 UTSW 14 20,612,176 (GRCm39) missense probably benign 0.00
R8775:Usp54 UTSW 14 20,638,466 (GRCm39) missense probably benign 0.03
R8775-TAIL:Usp54 UTSW 14 20,638,466 (GRCm39) missense probably benign 0.03
R9080:Usp54 UTSW 14 20,612,308 (GRCm39) missense probably damaging 1.00
R9121:Usp54 UTSW 14 20,631,523 (GRCm39) critical splice donor site probably null
R9139:Usp54 UTSW 14 20,627,162 (GRCm39) missense probably benign 0.00
R9433:Usp54 UTSW 14 20,611,678 (GRCm39) missense probably benign
R9613:Usp54 UTSW 14 20,600,438 (GRCm39) missense probably damaging 0.97
RF004:Usp54 UTSW 14 20,611,368 (GRCm39) missense possibly damaging 0.90
X0024:Usp54 UTSW 14 20,627,319 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CTGCTGTGCTGTAGAAATCTCACCC -3'
(R):5'- TCATCGTTCCAGAACTGATGCTTCC -3'

Sequencing Primer
(F):5'- CTTCCAGCAGCATTTGATAGAGC -3'
(R):5'- AGCCTCAGCTAACCTACACT -3'
Posted On 2014-03-14