Incidental Mutation 'R1463:Proc'
ID159274
Institutional Source Beutler Lab
Gene Symbol Proc
Ensembl Gene ENSMUSG00000024386
Gene Nameprotein C
SynonymsPC, inactivator of coagulation factors Va, VIII
MMRRC Submission 039517-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1463 (G1)
Quality Score145
Status Validated
Chromosome18
Chromosomal Location32123129-32139570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32133438 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 112 (D112G)
Ref Sequence ENSEMBL: ENSMUSP00000132226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171765]
Predicted Effect possibly damaging
Transcript: ENSMUST00000171765
AA Change: D112G

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132226
Gene: ENSMUSG00000024386
AA Change: D112G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
GLA 24 86 6.66e-30 SMART
EGF_CA 87 131 1.25e-6 SMART
EGF 138 175 3.62e-3 SMART
low complexity region 201 210 N/A INTRINSIC
Tryp_SPc 211 444 2.6e-82 SMART
Meta Mutation Damage Score 0.6831 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: This gene encodes the vitamin K-dependent protein C, which plays a vital role in the anticoagulation pathway. The encoded protein undergoes proteolytic processing including activation by thrombin-thrombomodulin complex to form the anticoagulant serine protease that degrades activated coagulation factors. A complete lack of the encoded protein in mice results in severe perinatal consumptive coagulopathy in the brain and liver, resulting in death within 24 hours after birth. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Inactivation of the locus results in death within 24 hours of birth due to consumptive coagulopathy. Thromboses and bleeding are observed in the brains and livers of homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,073 probably benign Het
4931408C20Rik G T 1: 26,682,141 Y1319* probably null Het
Abca5 A T 11: 110,314,558 I299N probably damaging Het
Abcc8 T C 7: 46,154,512 T413A probably benign Het
Actc1 G A 2: 114,049,529 S201F probably damaging Het
Adam30 G A 3: 98,162,525 C558Y probably damaging Het
Adcy4 T A 14: 55,778,939 I352F probably damaging Het
Adgrl4 A T 3: 151,510,596 D472V probably damaging Het
Afap1l2 T A 19: 56,930,151 M117L probably benign Het
AI597479 T C 1: 43,113,229 V229A probably damaging Het
Ascc1 T C 10: 60,062,516 V267A probably benign Het
Asxl3 A G 18: 22,516,753 S600G possibly damaging Het
Atg14 T C 14: 47,548,994 I268V probably benign Het
Bcas1 C T 2: 170,418,664 V32I probably benign Het
Cacna1c G T 6: 118,593,994 D2106E probably benign Het
Cacna1i A G 15: 80,379,054 H1440R possibly damaging Het
Catsper2 G A 2: 121,406,446 T240M probably damaging Het
Cd163 A G 6: 124,311,447 E279G probably damaging Het
Cdx2 C T 5: 147,306,660 S108N probably benign Het
Cenpf A T 1: 189,654,739 N1781K probably damaging Het
Cgref1 T A 5: 30,935,994 probably benign Het
Clcn4 C T 7: 7,296,764 W22* probably null Het
Cntn2 A G 1: 132,521,137 probably null Het
Cntn5 C T 9: 9,673,796 probably null Het
Cpeb3 A G 19: 37,139,100 M377T probably benign Het
Cryge T A 1: 65,048,838 R135* probably null Het
Ctdsp2 C A 10: 126,993,921 probably benign Het
Ctsll3 G A 13: 60,801,275 probably benign Het
Cuzd1 C A 7: 131,316,642 G189C probably damaging Het
Dmbt1 T A 7: 131,109,637 probably null Het
Dnajc13 A T 9: 104,178,940 S1587R probably damaging Het
Dock4 GCTCAGTGTATC GC 12: 40,816,325 probably null Het
Dock6 T C 9: 21,831,906 H701R probably damaging Het
Edem3 A G 1: 151,807,510 T646A possibly damaging Het
Esrra A C 19: 6,912,455 D160E probably benign Het
Fbn2 T C 18: 58,010,380 T2868A probably benign Het
Galnt7 T A 8: 57,652,858 M41L probably benign Het
Gbf1 T C 19: 46,271,545 probably benign Het
Glyat A G 19: 12,648,103 N63S probably damaging Het
Gm9376 A T 14: 118,267,482 M109L probably benign Het
H2-M10.3 A G 17: 36,366,720 V222A probably damaging Het
Ifna12 T G 4: 88,602,956 D118A possibly damaging Het
Inpp5j T C 11: 3,501,147 M501V probably benign Het
Itpr3 C T 17: 27,117,154 probably benign Het
Ivns1abp A G 1: 151,361,540 N527S probably benign Het
Kif13a T C 13: 46,929,612 T4A possibly damaging Het
Kif3b T C 2: 153,330,153 *748Q probably null Het
Klf8 C T X: 153,384,681 Q241* probably null Het
Kras A T 6: 145,225,061 probably benign Het
Lamc3 C A 2: 31,887,411 T23K probably benign Het
Lrrc74b T A 16: 17,559,873 H47L probably benign Het
Ly75 A G 2: 60,368,757 probably null Het
Map3k21 G A 8: 125,942,137 G821S probably benign Het
Mettl14 A G 3: 123,374,073 probably benign Het
Mettl5 T C 2: 69,885,246 probably benign Het
Mier3 A G 13: 111,711,755 D301G probably damaging Het
Mipep T C 14: 60,788,146 probably benign Het
Mmp21 T C 7: 133,675,859 probably null Het
Msh4 A G 3: 153,857,570 L723P probably damaging Het
Muc5b T C 7: 141,859,080 V1921A unknown Het
Myo1e G A 9: 70,338,756 E410K possibly damaging Het
Nav2 T G 7: 49,535,962 I951S probably damaging Het
Npc1 G A 18: 12,191,830 T1202I probably damaging Het
Olfr1441 C T 19: 12,422,888 T193I probably benign Het
Olfr218 A G 1: 173,203,367 K4E probably benign Het
Olfr324 A G 11: 58,598,121 R242G probably damaging Het
Patl2 C T 2: 122,123,735 V452M probably benign Het
Pcdh18 A G 3: 49,755,405 V487A probably damaging Het
Pdzph1 C T 17: 58,932,445 A963T probably damaging Het
Pkd1l1 C T 11: 8,916,302 V518M probably damaging Het
Plcd3 A G 11: 103,078,373 F256S probably damaging Het
Ptges2 T A 2: 32,400,862 probably null Het
Pth2r A T 1: 65,363,277 R312W probably damaging Het
Rbbp6 C T 7: 122,992,453 H546Y possibly damaging Het
Retreg2 A G 1: 75,146,520 E364G probably damaging Het
Rxrb G A 17: 34,034,160 C185Y probably damaging Het
Sept2 T A 1: 93,499,315 N133K possibly damaging Het
Serpina3b T A 12: 104,138,710 S382T probably benign Het
Serpinb9e T C 13: 33,255,116 F175S probably benign Het
Slc19a2 C T 1: 164,257,197 H219Y probably damaging Het
Slfn9 A T 11: 82,981,698 D737E possibly damaging Het
Snx31 T C 15: 36,539,298 E144G probably null Het
Sp2 A G 11: 96,963,456 probably benign Het
Spag9 C T 11: 94,116,837 L1117F probably damaging Het
Syndig1l A T 12: 84,680,363 probably benign Het
Sypl A T 12: 32,974,333 probably benign Het
Tmem169 T C 1: 72,300,696 M95T probably benign Het
Tmem206 T C 1: 191,328,289 probably benign Het
Tnfrsf17 A G 16: 11,315,202 Y48C possibly damaging Het
Ttn A T 2: 76,827,515 probably benign Het
Uap1 G C 1: 170,150,383 H366Q probably benign Het
Ulbp1 A G 10: 7,446,557 probably benign Het
Urb2 T C 8: 124,030,908 V1118A probably benign Het
Usp54 T C 14: 20,550,190 N1493S probably benign Het
Vmn1r129 C A 7: 21,360,730 V188F probably benign Het
Vmn1r226 A T 17: 20,687,732 L75F probably benign Het
Wdr78 T A 4: 103,087,418 L245F possibly damaging Het
Wisp1 T A 15: 66,919,271 N307K possibly damaging Het
Yes1 T A 5: 32,651,702 S137R probably benign Het
Zfp804b A G 5: 7,179,372 probably benign Het
Other mutations in Proc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Proc APN 18 32123513 missense probably benign 0.05
IGL01071:Proc APN 18 32123717 missense probably damaging 1.00
IGL01287:Proc APN 18 32123820 splice site probably benign
IGL01298:Proc APN 18 32123552 missense probably benign 0.01
IGL01898:Proc APN 18 32133145 critical splice donor site probably null
IGL01977:Proc APN 18 32127419 missense probably benign 0.02
IGL02040:Proc APN 18 32134860 missense probably benign 0.07
IGL02724:Proc APN 18 32134872 missense probably damaging 1.00
IGL02852:Proc APN 18 32125155 missense probably damaging 1.00
IGL02901:Proc APN 18 32123625 missense possibly damaging 0.89
IGL03401:Proc APN 18 32123273 missense possibly damaging 0.96
R0110:Proc UTSW 18 32125118 missense probably benign 0.26
R0131:Proc UTSW 18 32135898 missense probably benign 0.01
R0510:Proc UTSW 18 32125118 missense probably benign 0.26
R0988:Proc UTSW 18 32133483 missense probably benign
R1455:Proc UTSW 18 32123398 missense probably damaging 1.00
R1546:Proc UTSW 18 32127410 missense probably damaging 1.00
R1711:Proc UTSW 18 32127406 missense probably benign 0.05
R3414:Proc UTSW 18 32123685 missense probably benign 0.00
R3911:Proc UTSW 18 32123705 missense probably damaging 1.00
R4276:Proc UTSW 18 32135914 missense probably benign 0.00
R4598:Proc UTSW 18 32123459 missense probably damaging 1.00
R4623:Proc UTSW 18 32127473 missense probably benign 0.32
R4758:Proc UTSW 18 32123810 missense probably damaging 0.97
R4941:Proc UTSW 18 32125113 missense possibly damaging 0.60
R5917:Proc UTSW 18 32127460 missense probably benign 0.07
R6349:Proc UTSW 18 32133433 missense probably benign 0.00
R6636:Proc UTSW 18 32123760 missense probably benign 0.00
R6735:Proc UTSW 18 32123648 missense probably benign 0.01
R7110:Proc UTSW 18 32133388 missense probably benign 0.30
R7310:Proc UTSW 18 32135899 missense probably benign 0.03
R7409:Proc UTSW 18 32127460 missense probably benign 0.03
R7597:Proc UTSW 18 32123636 missense probably damaging 1.00
R7598:Proc UTSW 18 32135876 missense probably benign 0.00
X0021:Proc UTSW 18 32123507 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TAGTGCAAGCAGCCGCCATTGTTC -3'
(R):5'- AGATGTTTGTCTGGAAGCCCTTCCC -3'

Sequencing Primer
(F):5'- ACCCGACAGTCCTGGAAG -3'
(R):5'- TCCTAGACACCTCGTATTCAGGAG -3'
Posted On2014-03-14