Incidental Mutation 'R1463:Fbn2'
ID159275
Institutional Source Beutler Lab
Gene Symbol Fbn2
Ensembl Gene ENSMUSG00000024598
Gene Namefibrillin 2
SynonymsFib-2, sy, Sne
MMRRC Submission 039517-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.827) question?
Stock #R1463 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location58008623-58209926 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58010380 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2868 (T2868A)
Ref Sequence ENSEMBL: ENSMUSP00000025497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025497]
Predicted Effect probably benign
Transcript: ENSMUST00000025497
AA Change: T2868A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025497
Gene: ENSMUSG00000024598
AA Change: T2868A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
low complexity region 68 77 N/A INTRINSIC
EGF 148 176 1.15e1 SMART
EGF 179 208 1.26e-2 SMART
Pfam:TB 224 262 3.7e-10 PFAM
EGF_CA 276 317 8.3e-12 SMART
EGF_CA 318 359 9.25e-10 SMART
Pfam:TB 374 416 4.3e-13 PFAM
low complexity region 435 450 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
EGF 490 527 1.13e-4 SMART
EGF_CA 528 567 2.26e-13 SMART
EGF_CA 568 609 9.03e-13 SMART
EGF_CA 610 650 6.2e-11 SMART
EGF_CA 651 691 7.75e-12 SMART
Pfam:TB 707 748 5.2e-15 PFAM
EGF_CA 761 802 6.29e-12 SMART
EGF_CA 803 844 1.97e-13 SMART
EGF_CA 845 884 1.61e-9 SMART
Pfam:TB 899 935 1.8e-9 PFAM
EGF_CA 948 989 4.7e-11 SMART
Pfam:TB 1004 1044 1.3e-16 PFAM
EGF_CA 1066 1107 3.05e-10 SMART
EGF_CA 1108 1150 2.19e-11 SMART
EGF_CA 1151 1192 2.04e-11 SMART
EGF_CA 1193 1234 3.15e-12 SMART
EGF_CA 1235 1275 1.82e-8 SMART
EGF_CA 1276 1317 9.91e-10 SMART
EGF_CA 1318 1359 1.48e-8 SMART
EGF_CA 1360 1400 6.54e-10 SMART
EGF_CA 1401 1441 4.63e-10 SMART
EGF_CA 1442 1483 7.75e-12 SMART
EGF_CA 1484 1524 5.23e-9 SMART
EGF_CA 1525 1565 2.13e-9 SMART
Pfam:TB 1585 1625 3.4e-15 PFAM
EGF_CA 1643 1684 6.74e-12 SMART
EGF_CA 1685 1726 1.06e-9 SMART
Pfam:TB 1741 1783 1.2e-17 PFAM
EGF_CA 1801 1842 7.34e-13 SMART
EGF_CA 1843 1884 4.15e-12 SMART
EGF_CA 1885 1926 5.23e-9 SMART
EGF_CA 1927 1965 5.87e-12 SMART
EGF_CA 1966 2008 1.11e-12 SMART
EGF_CA 2009 2048 1.26e-11 SMART
EGF_CA 2049 2090 7.12e-11 SMART
Pfam:TB 2105 2147 1.2e-15 PFAM
EGF_CA 2164 2205 2.89e-11 SMART
EGF_CA 2206 2245 1.1e-11 SMART
EGF_CA 2246 2286 3.76e-10 SMART
EGF_CA 2287 2330 1.44e-6 SMART
EGF_CA 2331 2372 1.16e-10 SMART
Pfam:TB 2387 2429 1.9e-16 PFAM
EGF_CA 2442 2483 8.43e-13 SMART
EGF_CA 2484 2524 4.96e-10 SMART
EGF_CA 2525 2563 7.63e-11 SMART
EGF_CA 2564 2606 6.44e-9 SMART
EGF_CA 2607 2646 2.28e-9 SMART
EGF_CA 2647 2687 1.79e-7 SMART
EGF_CA 2688 2727 3.45e-9 SMART
low complexity region 2774 2786 N/A INTRINSIC
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of connective tissue microfibrils and may be involved in elastic fiber assembly. Mutations in this gene cause congenital contractural arachnodactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous, chemically-induced, and targeted null mutations show bilateral syndactyly with fusion of both soft and hard tissues. Deafness found in an X-ray induced allelic mutant is apparently due to the joint disruption of a linked gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,073 probably benign Het
4931408C20Rik G T 1: 26,682,141 Y1319* probably null Het
Abca5 A T 11: 110,314,558 I299N probably damaging Het
Abcc8 T C 7: 46,154,512 T413A probably benign Het
Actc1 G A 2: 114,049,529 S201F probably damaging Het
Adam30 G A 3: 98,162,525 C558Y probably damaging Het
Adcy4 T A 14: 55,778,939 I352F probably damaging Het
Adgrl4 A T 3: 151,510,596 D472V probably damaging Het
Afap1l2 T A 19: 56,930,151 M117L probably benign Het
AI597479 T C 1: 43,113,229 V229A probably damaging Het
Ascc1 T C 10: 60,062,516 V267A probably benign Het
Asxl3 A G 18: 22,516,753 S600G possibly damaging Het
Atg14 T C 14: 47,548,994 I268V probably benign Het
Bcas1 C T 2: 170,418,664 V32I probably benign Het
Cacna1c G T 6: 118,593,994 D2106E probably benign Het
Cacna1i A G 15: 80,379,054 H1440R possibly damaging Het
Catsper2 G A 2: 121,406,446 T240M probably damaging Het
Cd163 A G 6: 124,311,447 E279G probably damaging Het
Cdx2 C T 5: 147,306,660 S108N probably benign Het
Cenpf A T 1: 189,654,739 N1781K probably damaging Het
Cgref1 T A 5: 30,935,994 probably benign Het
Clcn4 C T 7: 7,296,764 W22* probably null Het
Cntn2 A G 1: 132,521,137 probably null Het
Cntn5 C T 9: 9,673,796 probably null Het
Cpeb3 A G 19: 37,139,100 M377T probably benign Het
Cryge T A 1: 65,048,838 R135* probably null Het
Ctdsp2 C A 10: 126,993,921 probably benign Het
Ctsll3 G A 13: 60,801,275 probably benign Het
Cuzd1 C A 7: 131,316,642 G189C probably damaging Het
Dmbt1 T A 7: 131,109,637 probably null Het
Dnajc13 A T 9: 104,178,940 S1587R probably damaging Het
Dock4 GCTCAGTGTATC GC 12: 40,816,325 probably null Het
Dock6 T C 9: 21,831,906 H701R probably damaging Het
Edem3 A G 1: 151,807,510 T646A possibly damaging Het
Esrra A C 19: 6,912,455 D160E probably benign Het
Galnt7 T A 8: 57,652,858 M41L probably benign Het
Gbf1 T C 19: 46,271,545 probably benign Het
Glyat A G 19: 12,648,103 N63S probably damaging Het
Gm9376 A T 14: 118,267,482 M109L probably benign Het
H2-M10.3 A G 17: 36,366,720 V222A probably damaging Het
Ifna12 T G 4: 88,602,956 D118A possibly damaging Het
Inpp5j T C 11: 3,501,147 M501V probably benign Het
Itpr3 C T 17: 27,117,154 probably benign Het
Ivns1abp A G 1: 151,361,540 N527S probably benign Het
Kif13a T C 13: 46,929,612 T4A possibly damaging Het
Kif3b T C 2: 153,330,153 *748Q probably null Het
Klf8 C T X: 153,384,681 Q241* probably null Het
Kras A T 6: 145,225,061 probably benign Het
Lamc3 C A 2: 31,887,411 T23K probably benign Het
Lrrc74b T A 16: 17,559,873 H47L probably benign Het
Ly75 A G 2: 60,368,757 probably null Het
Map3k21 G A 8: 125,942,137 G821S probably benign Het
Mettl14 A G 3: 123,374,073 probably benign Het
Mettl5 T C 2: 69,885,246 probably benign Het
Mier3 A G 13: 111,711,755 D301G probably damaging Het
Mipep T C 14: 60,788,146 probably benign Het
Mmp21 T C 7: 133,675,859 probably null Het
Msh4 A G 3: 153,857,570 L723P probably damaging Het
Muc5b T C 7: 141,859,080 V1921A unknown Het
Myo1e G A 9: 70,338,756 E410K possibly damaging Het
Nav2 T G 7: 49,535,962 I951S probably damaging Het
Npc1 G A 18: 12,191,830 T1202I probably damaging Het
Olfr1441 C T 19: 12,422,888 T193I probably benign Het
Olfr218 A G 1: 173,203,367 K4E probably benign Het
Olfr324 A G 11: 58,598,121 R242G probably damaging Het
Patl2 C T 2: 122,123,735 V452M probably benign Het
Pcdh18 A G 3: 49,755,405 V487A probably damaging Het
Pdzph1 C T 17: 58,932,445 A963T probably damaging Het
Pkd1l1 C T 11: 8,916,302 V518M probably damaging Het
Plcd3 A G 11: 103,078,373 F256S probably damaging Het
Proc T C 18: 32,133,438 D112G possibly damaging Het
Ptges2 T A 2: 32,400,862 probably null Het
Pth2r A T 1: 65,363,277 R312W probably damaging Het
Rbbp6 C T 7: 122,992,453 H546Y possibly damaging Het
Retreg2 A G 1: 75,146,520 E364G probably damaging Het
Rxrb G A 17: 34,034,160 C185Y probably damaging Het
Sept2 T A 1: 93,499,315 N133K possibly damaging Het
Serpina3b T A 12: 104,138,710 S382T probably benign Het
Serpinb9e T C 13: 33,255,116 F175S probably benign Het
Slc19a2 C T 1: 164,257,197 H219Y probably damaging Het
Slfn9 A T 11: 82,981,698 D737E possibly damaging Het
Snx31 T C 15: 36,539,298 E144G probably null Het
Sp2 A G 11: 96,963,456 probably benign Het
Spag9 C T 11: 94,116,837 L1117F probably damaging Het
Syndig1l A T 12: 84,680,363 probably benign Het
Sypl A T 12: 32,974,333 probably benign Het
Tmem169 T C 1: 72,300,696 M95T probably benign Het
Tmem206 T C 1: 191,328,289 probably benign Het
Tnfrsf17 A G 16: 11,315,202 Y48C possibly damaging Het
Ttn A T 2: 76,827,515 probably benign Het
Uap1 G C 1: 170,150,383 H366Q probably benign Het
Ulbp1 A G 10: 7,446,557 probably benign Het
Urb2 T C 8: 124,030,908 V1118A probably benign Het
Usp54 T C 14: 20,550,190 N1493S probably benign Het
Vmn1r129 C A 7: 21,360,730 V188F probably benign Het
Vmn1r226 A T 17: 20,687,732 L75F probably benign Het
Wdr78 T A 4: 103,087,418 L245F possibly damaging Het
Wisp1 T A 15: 66,919,271 N307K possibly damaging Het
Yes1 T A 5: 32,651,702 S137R probably benign Het
Zfp804b A G 5: 7,179,372 probably benign Het
Other mutations in Fbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Fbn2 APN 18 58037809 missense possibly damaging 0.81
IGL00780:Fbn2 APN 18 58095988 missense probably damaging 1.00
IGL00923:Fbn2 APN 18 58012325 missense probably benign 0.00
IGL01011:Fbn2 APN 18 58095240 splice site probably benign
IGL01123:Fbn2 APN 18 58104081 missense possibly damaging 0.62
IGL01304:Fbn2 APN 18 58061745 missense probably damaging 0.97
IGL01339:Fbn2 APN 18 58113370 missense possibly damaging 0.75
IGL01465:Fbn2 APN 18 58203833 missense probably null 0.67
IGL01608:Fbn2 APN 18 58053704 nonsense probably null
IGL01682:Fbn2 APN 18 58072671 missense probably damaging 1.00
IGL01752:Fbn2 APN 18 58075977 splice site probably null
IGL01764:Fbn2 APN 18 58045351 missense probably damaging 1.00
IGL02002:Fbn2 APN 18 58114553 missense probably benign 0.01
IGL02010:Fbn2 APN 18 58037722 missense probably damaging 0.99
IGL02029:Fbn2 APN 18 58209603 missense probably benign 0.04
IGL02037:Fbn2 APN 18 58096015 missense probably damaging 1.00
IGL02350:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02357:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02653:Fbn2 APN 18 58076705 missense probably benign
IGL03233:Fbn2 APN 18 58102377 missense probably benign 0.39
IGL03347:Fbn2 APN 18 58013665 missense probably damaging 1.00
IGL03410:Fbn2 APN 18 58050243 missense possibly damaging 0.95
pinch UTSW 18 58069184 missense probably damaging 1.00
stick UTSW 18 58071819 missense possibly damaging 0.94
tweak UTSW 18 58058389 missense probably damaging 1.00
PIT4434001:Fbn2 UTSW 18 58096062 missense probably damaging 0.99
R0020:Fbn2 UTSW 18 58105164 missense probably damaging 1.00
R0069:Fbn2 UTSW 18 58069184 missense probably damaging 1.00
R0107:Fbn2 UTSW 18 58056203 missense probably benign 0.00
R0116:Fbn2 UTSW 18 58102373 nonsense probably null
R0277:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0284:Fbn2 UTSW 18 58050290 splice site probably benign
R0316:Fbn2 UTSW 18 58113325 missense probably damaging 1.00
R0323:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0421:Fbn2 UTSW 18 58027804 splice site probably benign
R0455:Fbn2 UTSW 18 58035336 missense probably damaging 1.00
R0504:Fbn2 UTSW 18 58039460 missense possibly damaging 0.94
R0520:Fbn2 UTSW 18 58013749 missense probably damaging 1.00
R0632:Fbn2 UTSW 18 58037747 missense probably damaging 1.00
R0638:Fbn2 UTSW 18 58045374 missense probably damaging 0.98
R0645:Fbn2 UTSW 18 58058389 missense probably damaging 1.00
R1051:Fbn2 UTSW 18 58012353 missense probably damaging 0.99
R1209:Fbn2 UTSW 18 58070016 missense probably benign 0.00
R1319:Fbn2 UTSW 18 58200610 missense possibly damaging 0.88
R1400:Fbn2 UTSW 18 58080193 missense possibly damaging 0.90
R1437:Fbn2 UTSW 18 58053659 missense possibly damaging 0.68
R1612:Fbn2 UTSW 18 58061752 missense probably damaging 1.00
R1623:Fbn2 UTSW 18 58048548 missense possibly damaging 0.61
R1629:Fbn2 UTSW 18 58026538 missense probably damaging 1.00
R1639:Fbn2 UTSW 18 58058462 missense probably benign 0.41
R1722:Fbn2 UTSW 18 58048052 critical splice acceptor site probably null
R1749:Fbn2 UTSW 18 58050276 missense probably benign 0.35
R1802:Fbn2 UTSW 18 58052976 nonsense probably null
R1850:Fbn2 UTSW 18 58039305 splice site probably benign
R1913:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R2045:Fbn2 UTSW 18 58090658 missense probably damaging 1.00
R2064:Fbn2 UTSW 18 58048849 missense probably damaging 0.99
R2143:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2144:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2149:Fbn2 UTSW 18 58102325 splice site probably null
R2207:Fbn2 UTSW 18 58081399 nonsense probably null
R2219:Fbn2 UTSW 18 58052963 missense possibly damaging 0.79
R2263:Fbn2 UTSW 18 58095176 splice site probably benign
R2375:Fbn2 UTSW 18 58035966 missense probably damaging 1.00
R2424:Fbn2 UTSW 18 58203787 missense probably damaging 0.99
R2504:Fbn2 UTSW 18 58093359 missense probably damaging 0.99
R2879:Fbn2 UTSW 18 58069242 missense probably damaging 0.97
R3040:Fbn2 UTSW 18 58093387 missense probably damaging 1.00
R3080:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R3625:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R3901:Fbn2 UTSW 18 58066011 missense probably damaging 0.97
R4089:Fbn2 UTSW 18 58053769 missense probably benign 0.01
R4133:Fbn2 UTSW 18 58095962 missense possibly damaging 0.82
R4155:Fbn2 UTSW 18 58023287 nonsense probably null
R4288:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4289:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4363:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R4559:Fbn2 UTSW 18 58076074 missense probably benign 0.00
R4601:Fbn2 UTSW 18 58053733 missense probably damaging 1.00
R4609:Fbn2 UTSW 18 58190269 nonsense probably null
R4626:Fbn2 UTSW 18 58013747 nonsense probably null
R4638:Fbn2 UTSW 18 58010304 missense probably benign 0.01
R4675:Fbn2 UTSW 18 58040193 missense possibly damaging 0.95
R4707:Fbn2 UTSW 18 58056272 missense probably damaging 1.00
R4758:Fbn2 UTSW 18 58026386 missense probably benign 0.00
R4945:Fbn2 UTSW 18 58050253 missense possibly damaging 0.53
R4955:Fbn2 UTSW 18 58058383 missense possibly damaging 0.61
R4980:Fbn2 UTSW 18 58010631 missense probably benign 0.05
R4998:Fbn2 UTSW 18 58072631 missense probably damaging 1.00
R5133:Fbn2 UTSW 18 58039340 missense probably damaging 0.99
R5322:Fbn2 UTSW 18 58039315 missense probably benign 0.00
R5414:Fbn2 UTSW 18 58093405 missense probably damaging 0.96
R5538:Fbn2 UTSW 18 58071901 missense probably benign 0.22
R5557:Fbn2 UTSW 18 58115659 missense probably benign 0.00
R5754:Fbn2 UTSW 18 58124311 missense probably benign 0.04
R5769:Fbn2 UTSW 18 58105199 missense probably damaging 1.00
R5790:Fbn2 UTSW 18 58076696 missense probably benign 0.34
R5830:Fbn2 UTSW 18 58114469 missense probably benign 0.01
R5845:Fbn2 UTSW 18 58053768 missense possibly damaging 0.89
R5880:Fbn2 UTSW 18 58023282 nonsense probably null
R5907:Fbn2 UTSW 18 58045337 missense probably damaging 1.00
R5948:Fbn2 UTSW 18 58037049 missense probably damaging 1.00
R5955:Fbn2 UTSW 18 58044256 missense probably damaging 1.00
R5974:Fbn2 UTSW 18 58048920 missense probably damaging 1.00
R6010:Fbn2 UTSW 18 58069524 missense probably benign 0.31
R6024:Fbn2 UTSW 18 58076836 missense probably benign 0.03
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6315:Fbn2 UTSW 18 58054953 critical splice acceptor site probably null
R6437:Fbn2 UTSW 18 58113363 missense probably damaging 1.00
R6519:Fbn2 UTSW 18 58063575 missense possibly damaging 0.61
R6520:Fbn2 UTSW 18 58102390 missense probably damaging 1.00
R6734:Fbn2 UTSW 18 58035960 missense probably damaging 1.00
R6755:Fbn2 UTSW 18 58113333 missense possibly damaging 0.89
R6789:Fbn2 UTSW 18 58010614 missense probably benign 0.00
R6801:Fbn2 UTSW 18 58113348 missense probably benign 0.04
R6862:Fbn2 UTSW 18 58124321 missense probably benign 0.04
R6900:Fbn2 UTSW 18 58076831 missense probably benign
R6906:Fbn2 UTSW 18 58071819 missense possibly damaging 0.94
R6919:Fbn2 UTSW 18 58124187 intron probably null
R6950:Fbn2 UTSW 18 58035921 missense probably null 0.21
R6985:Fbn2 UTSW 18 58068388 missense probably damaging 1.00
R7056:Fbn2 UTSW 18 58076726 missense probably benign
R7199:Fbn2 UTSW 18 58053761 nonsense probably null
R7219:Fbn2 UTSW 18 58053027 missense probably benign 0.04
R7226:Fbn2 UTSW 18 58037070 missense probably damaging 1.00
R7260:Fbn2 UTSW 18 58066116 missense probably benign 0.14
R7414:Fbn2 UTSW 18 58096050 missense probably damaging 1.00
R7485:Fbn2 UTSW 18 58071840 missense possibly damaging 0.50
R7523:Fbn2 UTSW 18 58066080 missense probably benign 0.01
R7549:Fbn2 UTSW 18 58020464 nonsense probably null
R7619:Fbn2 UTSW 18 58080227 missense possibly damaging 0.46
R7638:Fbn2 UTSW 18 58105136 missense probably damaging 1.00
R7789:Fbn2 UTSW 18 58039313 missense probably benign 0.22
X0062:Fbn2 UTSW 18 58056213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGAGGGTCAACATTCCGAAG -3'
(R):5'- ATGGACAGCCCAGTCAACATGAAG -3'

Sequencing Primer
(F):5'- GGTCAACATTCCGAAGTCTGAATC -3'
(R):5'- TTGGCTCCAAGGAGCACATC -3'
Posted On2014-03-14