Incidental Mutation 'R1433:Carf'
ID159285
Institutional Source Beutler Lab
Gene Symbol Carf
Ensembl Gene ENSMUSG00000026017
Gene Namecalcium response factor
SynonymsAls2cr8
MMRRC Submission 039488-MU
Accession Numbers

Genbank: NM_139150; MGI: 2182269

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1433 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location60098247-60153953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 60124858 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 43 (M43R)
Ref Sequence ENSEMBL: ENSMUSP00000121293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027171] [ENSMUST00000124986] [ENSMUST00000130075] [ENSMUST00000180952] [ENSMUST00000186107] [ENSMUST00000187978]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027171
AA Change: M69R

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027171
Gene: ENSMUSG00000026017
AA Change: M69R

DomainStartEndE-ValueType
Pfam:ALS2CR8 227 457 6.4e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124986
AA Change: M43R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000130075
AA Change: M69R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000180952
AA Change: M104R

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137825
Gene: ENSMUSG00000026017
AA Change: M104R

DomainStartEndE-ValueType
Pfam:ALS2CR8 224 458 1.2e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186107
AA Change: M69R

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139554
Gene: ENSMUSG00000026017
AA Change: M69R

DomainStartEndE-ValueType
low complexity region 239 255 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187978
AA Change: M104R

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141169
Gene: ENSMUSG00000026017
AA Change: M104R

DomainStartEndE-ValueType
Pfam:ALS2CR8 224 458 1.2e-64 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele have aberrant learning and memory. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(2)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A T 6: 116,652,262 S189C possibly damaging Het
Acp1 C T 12: 30,895,935 E140K possibly damaging Het
Acsm4 T A 7: 119,693,819 D57E probably damaging Het
Adamts9 A G 6: 92,849,290 probably null Het
Aen T A 7: 78,907,312 Y303N probably damaging Het
Alcam T C 16: 52,295,752 probably null Het
Apol7b A G 15: 77,425,546 L17P probably damaging Het
Cacna1c A T 6: 118,652,793 Y1058* probably null Het
Camk2d T C 3: 126,808,224 V354A probably benign Het
Casp8 T A 1: 58,824,124 F81Y probably damaging Het
Cd74 G A 18: 60,803,992 R20H probably benign Het
Cers5 A T 15: 99,745,931 Y16* probably null Het
Chuk A T 19: 44,078,958 M586K probably null Het
D130043K22Rik C A 13: 24,871,341 P496Q probably damaging Het
Dab2 A G 15: 6,429,938 R311G probably damaging Het
Diaph1 A T 18: 37,905,134 I48N unknown Het
Dnajc13 T C 9: 104,180,121 D1560G probably damaging Het
Dsg2 T C 18: 20,582,723 S241P probably damaging Het
Efcab5 T C 11: 77,105,378 D1119G probably benign Het
Efr3a G T 15: 65,869,057 probably benign Het
Evc2 A G 5: 37,393,083 K814E probably damaging Het
Gm5724 A G 6: 141,765,703 M94T probably benign Het
Hic2 A G 16: 17,258,822 D505G probably benign Het
Ing1 T A 8: 11,557,010 V34D probably damaging Het
Inpp5k A G 11: 75,637,491 M172V probably benign Het
Itgae T C 11: 73,115,592 V362A probably damaging Het
Lama2 T A 10: 27,187,754 R1346S probably damaging Het
Lrrc7 T C 3: 158,177,306 N450S probably damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Maml2 A T 9: 13,706,501 N381I probably damaging Het
Mettl15 T G 2: 109,092,921 E385D probably benign Het
Mthfr T A 4: 148,055,443 I623N possibly damaging Het
Muc4 A C 16: 32,753,020 N966T probably benign Het
Myoc A G 1: 162,648,996 Y423C probably damaging Het
Ncoa2 A T 1: 13,148,378 M1409K probably benign Het
Ncor2 T C 5: 125,109,975 probably benign Het
Numb T C 12: 83,797,259 E395G probably damaging Het
Oas1g A G 5: 120,881,949 F198S probably damaging Het
Olfr1367 T C 13: 21,347,024 V32A probably benign Het
Olfr181 A G 16: 58,925,686 V295A probably benign Het
Prdm13 T A 4: 21,678,909 Y527F probably damaging Het
Prr14l A G 5: 32,828,833 L1106P probably damaging Het
Ptbp1 T A 10: 79,863,273 I555N probably damaging Het
Ptchd4 A T 17: 42,503,715 T836S possibly damaging Het
Rlbp1 T C 7: 79,383,938 D3G probably benign Het
Sdk2 T C 11: 113,795,045 E1883G probably damaging Het
Serpinc1 A T 1: 160,993,404 K140N probably damaging Het
Serpind1 A T 16: 17,342,385 Y382F probably damaging Het
Slc28a3 T C 13: 58,563,106 E534G probably damaging Het
Ttyh2 T A 11: 114,710,179 I418N probably benign Het
Tubgcp4 C T 2: 121,175,424 Q98* probably null Het
Ugt2a2 A G 5: 87,464,106 L315P probably damaging Het
Vwa1 A T 4: 155,772,901 S147T probably damaging Het
Xylt1 T C 7: 117,591,952 V325A possibly damaging Het
Zfp335 T C 2: 164,899,456 H685R probably damaging Het
Other mutations in Carf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Carf APN 1 60124842 splice site probably benign
IGL00730:Carf APN 1 60147418 nonsense probably null
IGL00792:Carf APN 1 60126009 missense possibly damaging 0.73
IGL00913:Carf APN 1 60147955 missense probably benign 0.20
IGL01487:Carf APN 1 60109379 missense probably damaging 1.00
IGL02214:Carf APN 1 60148081 missense probably damaging 1.00
IGL03258:Carf APN 1 60109229 missense possibly damaging 0.93
IGL03285:Carf APN 1 60146154 missense probably damaging 1.00
3-1:Carf UTSW 1 60141468 missense possibly damaging 0.93
PIT4283001:Carf UTSW 1 60128002 missense probably benign 0.32
R0375:Carf UTSW 1 60144002 missense probably damaging 1.00
R0465:Carf UTSW 1 60131983 missense probably damaging 1.00
R0591:Carf UTSW 1 60125914 splice site probably benign
R1158:Carf UTSW 1 60147839 missense probably benign 0.22
R1464:Carf UTSW 1 60125906 splice site probably benign
R1467:Carf UTSW 1 60127993 missense possibly damaging 0.58
R1467:Carf UTSW 1 60127993 missense possibly damaging 0.58
R1546:Carf UTSW 1 60126036 critical splice donor site probably null
R1801:Carf UTSW 1 60141505 missense possibly damaging 0.60
R1977:Carf UTSW 1 60146136 missense probably damaging 1.00
R2086:Carf UTSW 1 60109411 missense probably damaging 1.00
R2163:Carf UTSW 1 60147486 splice site probably benign
R2198:Carf UTSW 1 60141484 missense probably damaging 1.00
R2238:Carf UTSW 1 60148034 missense probably benign
R2981:Carf UTSW 1 60139232 missense probably damaging 1.00
R4090:Carf UTSW 1 60136347 missense possibly damaging 0.94
R4573:Carf UTSW 1 60148112 missense probably benign 0.39
R4737:Carf UTSW 1 60109318 missense probably benign 0.00
R4906:Carf UTSW 1 60141367 missense probably damaging 1.00
R4965:Carf UTSW 1 60150637 missense probably damaging 0.99
R5080:Carf UTSW 1 60150613 missense probably damaging 0.98
R5184:Carf UTSW 1 60108174 missense probably damaging 0.99
R5949:Carf UTSW 1 60139313 missense probably damaging 1.00
R6135:Carf UTSW 1 60147963 missense probably damaging 1.00
R6346:Carf UTSW 1 60141540 nonsense probably null
R6886:Carf UTSW 1 60136254 splice site probably null
R7115:Carf UTSW 1 60148150 missense probably damaging 1.00
R7228:Carf UTSW 1 60109394 missense probably damaging 0.99
R7459:Carf UTSW 1 60128039 missense possibly damaging 0.93
R7755:Carf UTSW 1 60148055 missense probably benign 0.00
R7809:Carf UTSW 1 60144067 missense probably damaging 0.98
R8053:Carf UTSW 1 60128038 missense probably benign 0.42
R8137:Carf UTSW 1 60147965 missense probably benign 0.00
R8423:Carf UTSW 1 60150593 missense possibly damaging 0.95
Z1177:Carf UTSW 1 60136262 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCCTGGGACTATAGGCTATGTCAC -3'
(R):5'- GCTCACTGGTCATTTGGGAGGAAG -3'

Sequencing Primer
(F):5'- tcacactgatttttttgaatcttacc -3'
(R):5'- GAGTCAGCCAGCTTCATAGAATC -3'
Posted On2014-03-14