Incidental Mutation 'R1433:Serpinc1'
ID159286
Institutional Source Beutler Lab
Gene Symbol Serpinc1
Ensembl Gene ENSMUSG00000026715
Gene Nameserine (or cysteine) peptidase inhibitor, clade C (antithrombin), member 1
SynonymsAt3, At-3, antithrombin, ATIII
MMRRC Submission 039488-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1433 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location160978585-161005863 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 160993404 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 140 (K140N)
Ref Sequence ENSEMBL: ENSMUSP00000068971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064725] [ENSMUST00000191936] [ENSMUST00000194592] [ENSMUST00000195438] [ENSMUST00000195760]
Predicted Effect probably damaging
Transcript: ENSMUST00000064725
AA Change: K140N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068971
Gene: ENSMUSG00000026715
AA Change: K140N

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
SERPIN 93 462 5.55e-173 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191936
AA Change: K19N

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142122
Gene: ENSMUSG00000026715
AA Change: K19N

DomainStartEndE-ValueType
Pfam:Serpin 1 91 2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194455
Predicted Effect possibly damaging
Transcript: ENSMUST00000194592
AA Change: K140N

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141556
Gene: ENSMUSG00000026715
AA Change: K140N

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
SERPIN 93 286 8.3e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194777
Predicted Effect possibly damaging
Transcript: ENSMUST00000195438
AA Change: K19N

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141834
Gene: ENSMUSG00000026715
AA Change: K19N

DomainStartEndE-ValueType
Pfam:Serpin 1 97 1.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195760
SMART Domains Protein: ENSMUSP00000141864
Gene: ENSMUSG00000026715

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Blast:SERPIN 32 107 5e-43 BLAST
PDB:2GD4|C 32 107 3e-43 PDB
SCOP:d1e05i_ 35 107 4e-26 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma protease inhibitor and a member of the serpin superfamily. This protein inhibits thrombin as well as other activated serine proteases of the coagulation system, and it regulates the blood coagulation cascade. The protein includes two functional domains: the heparin binding-domain at the N-terminus of the mature protein, and the reactive site domain at the C-terminus. The inhibitory activity is enhanced by the presence of heparin. More than 120 mutations have been identified for this gene, many of which are known to cause antithrombin-III deficiency. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit extensive subcutaneous hemorrhage, fibrin deposits in the myocardium and liver, and lethality by embryonic day 16.5. Heterozygotes challenged with lipopolysaccharide show increased fibrin deposits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A T 6: 116,652,262 S189C possibly damaging Het
Acp1 C T 12: 30,895,935 E140K possibly damaging Het
Acsm4 T A 7: 119,693,819 D57E probably damaging Het
Adamts9 A G 6: 92,849,290 probably null Het
Aen T A 7: 78,907,312 Y303N probably damaging Het
Alcam T C 16: 52,295,752 probably null Het
Apol7b A G 15: 77,425,546 L17P probably damaging Het
Cacna1c A T 6: 118,652,793 Y1058* probably null Het
Camk2d T C 3: 126,808,224 V354A probably benign Het
Carf T G 1: 60,124,858 M43R probably damaging Het
Casp8 T A 1: 58,824,124 F81Y probably damaging Het
Cd74 G A 18: 60,803,992 R20H probably benign Het
Cers5 A T 15: 99,745,931 Y16* probably null Het
Chuk A T 19: 44,078,958 M586K probably null Het
D130043K22Rik C A 13: 24,871,341 P496Q probably damaging Het
Dab2 A G 15: 6,429,938 R311G probably damaging Het
Diaph1 A T 18: 37,905,134 I48N unknown Het
Dnajc13 T C 9: 104,180,121 D1560G probably damaging Het
Dsg2 T C 18: 20,582,723 S241P probably damaging Het
Efcab5 T C 11: 77,105,378 D1119G probably benign Het
Efr3a G T 15: 65,869,057 probably benign Het
Evc2 A G 5: 37,393,083 K814E probably damaging Het
Gm5724 A G 6: 141,765,703 M94T probably benign Het
Hic2 A G 16: 17,258,822 D505G probably benign Het
Ing1 T A 8: 11,557,010 V34D probably damaging Het
Inpp5k A G 11: 75,637,491 M172V probably benign Het
Itgae T C 11: 73,115,592 V362A probably damaging Het
Lama2 T A 10: 27,187,754 R1346S probably damaging Het
Lrrc7 T C 3: 158,177,306 N450S probably damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Maml2 A T 9: 13,706,501 N381I probably damaging Het
Mettl15 T G 2: 109,092,921 E385D probably benign Het
Mthfr T A 4: 148,055,443 I623N possibly damaging Het
Muc4 A C 16: 32,753,020 N966T probably benign Het
Myoc A G 1: 162,648,996 Y423C probably damaging Het
Ncoa2 A T 1: 13,148,378 M1409K probably benign Het
Ncor2 T C 5: 125,109,975 probably benign Het
Numb T C 12: 83,797,259 E395G probably damaging Het
Oas1g A G 5: 120,881,949 F198S probably damaging Het
Olfr1367 T C 13: 21,347,024 V32A probably benign Het
Olfr181 A G 16: 58,925,686 V295A probably benign Het
Prdm13 T A 4: 21,678,909 Y527F probably damaging Het
Prr14l A G 5: 32,828,833 L1106P probably damaging Het
Ptbp1 T A 10: 79,863,273 I555N probably damaging Het
Ptchd4 A T 17: 42,503,715 T836S possibly damaging Het
Rlbp1 T C 7: 79,383,938 D3G probably benign Het
Sdk2 T C 11: 113,795,045 E1883G probably damaging Het
Serpind1 A T 16: 17,342,385 Y382F probably damaging Het
Slc28a3 T C 13: 58,563,106 E534G probably damaging Het
Ttyh2 T A 11: 114,710,179 I418N probably benign Het
Tubgcp4 C T 2: 121,175,424 Q98* probably null Het
Ugt2a2 A G 5: 87,464,106 L315P probably damaging Het
Vwa1 A T 4: 155,772,901 S147T probably damaging Het
Xylt1 T C 7: 117,591,952 V325A possibly damaging Het
Zfp335 T C 2: 164,899,456 H685R probably damaging Het
Other mutations in Serpinc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Serpinc1 APN 1 160993400 missense probably damaging 1.00
IGL01923:Serpinc1 APN 1 160989546 missense probably damaging 0.98
IGL01987:Serpinc1 APN 1 160993407 missense probably damaging 1.00
IGL02272:Serpinc1 APN 1 160999992 missense probably damaging 1.00
IGL02574:Serpinc1 APN 1 161002459 missense probably benign 0.00
IGL02730:Serpinc1 APN 1 161000028 missense probably damaging 0.97
IGL02861:Serpinc1 APN 1 160999991 missense probably damaging 0.99
IGL03377:Serpinc1 APN 1 160993442 missense probably damaging 1.00
R0277:Serpinc1 UTSW 1 160989702 start codon destroyed probably null 1.00
R1294:Serpinc1 UTSW 1 160989641 missense probably damaging 0.98
R1368:Serpinc1 UTSW 1 160993524 missense probably damaging 1.00
R1436:Serpinc1 UTSW 1 160993411 missense possibly damaging 0.63
R1480:Serpinc1 UTSW 1 160995319 missense probably benign 0.00
R1703:Serpinc1 UTSW 1 160993517 missense probably damaging 1.00
R1775:Serpinc1 UTSW 1 160989647 missense probably benign 0.07
R2007:Serpinc1 UTSW 1 160993540 missense probably benign 0.05
R3757:Serpinc1 UTSW 1 161002365 missense probably benign 0.00
R5134:Serpinc1 UTSW 1 160997570 unclassified probably null
R5252:Serpinc1 UTSW 1 160989621 missense probably damaging 1.00
R7033:Serpinc1 UTSW 1 160997521 missense probably benign 0.04
R7254:Serpinc1 UTSW 1 160993618 missense probably benign 0.01
R7262:Serpinc1 UTSW 1 160989659 missense probably damaging 1.00
R7429:Serpinc1 UTSW 1 160995441 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGTCTACAGCCCCTTAAAGACCC -3'
(R):5'- GCTTGGCTCCATAGACAACCTCAC -3'

Sequencing Primer
(F):5'- TTAAAGACCCGGTGGCGTTC -3'
(R):5'- ACTAACATCTTGATAGCTCTCGTTG -3'
Posted On2014-03-14