Incidental Mutation 'R1433:Tubgcp4'
ID159291
Institutional Source Beutler Lab
Gene Symbol Tubgcp4
Ensembl Gene ENSMUSG00000027263
Gene Nametubulin, gamma complex associated protein 4
SynonymsD2Ertd435e, 4932441P04Rik
MMRRC Submission 039488-MU
Accession Numbers

Genbank: NM_153387

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1433 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121170654-121198770 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 121175424 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 98 (Q98*)
Ref Sequence ENSEMBL: ENSMUSP00000140417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039541] [ENSMUST00000110657] [ENSMUST00000110658] [ENSMUST00000146243] [ENSMUST00000163766] [ENSMUST00000186659]
Predicted Effect probably null
Transcript: ENSMUST00000039541
AA Change: Q98*
SMART Domains Protein: ENSMUSP00000044049
Gene: ENSMUSG00000027263
AA Change: Q98*

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 573 2.8e-111 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110657
AA Change: Q98*
SMART Domains Protein: ENSMUSP00000106285
Gene: ENSMUSG00000027263
AA Change: Q98*

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 3.1e-115 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110658
AA Change: Q98*
SMART Domains Protein: ENSMUSP00000106286
Gene: ENSMUSG00000027263
AA Change: Q98*

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 4.1e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144123
Predicted Effect probably benign
Transcript: ENSMUST00000146243
SMART Domains Protein: ENSMUSP00000120997
Gene: ENSMUSG00000050619

DomainStartEndE-ValueType
SCAN 13 118 4.23e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154633
Predicted Effect probably benign
Transcript: ENSMUST00000163766
SMART Domains Protein: ENSMUSP00000125987
Gene: ENSMUSG00000050619

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 5.9e-21 PFAM
Pfam:Myb_DNA-bind_4 434 519 1.3e-21 PFAM
low complexity region 553 567 N/A INTRINSIC
ZnF_C2H2 700 722 2.99e-4 SMART
ZnF_C2H2 728 750 2.75e-3 SMART
ZnF_C2H2 756 778 8.02e-5 SMART
ZnF_C2H2 784 806 1.13e-4 SMART
ZnF_C2H2 812 834 1.18e-2 SMART
ZnF_C2H2 840 862 1.33e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000186659
AA Change: Q98*
SMART Domains Protein: ENSMUSP00000140417
Gene: ENSMUSG00000027263
AA Change: Q98*

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 4.1e-115 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the gamma-tubulin ring complex, which is required for microtubule nucleation. In mammalian cells, the protein localizes to centrosomes in association with gamma-tubulin. Crystal structure analysis revealed a structure composed of five helical bundles arranged around conserved hydrophobic cores. An exposed surface area located in the C-terminal domain is essential and sufficient for direct binding to gamma-tubulin. Mutations in this gene that alter microtubule organization are associated with microcephaly and chorioretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A T 6: 116,652,262 S189C possibly damaging Het
Acp1 C T 12: 30,895,935 E140K possibly damaging Het
Acsm4 T A 7: 119,693,819 D57E probably damaging Het
Adamts9 A G 6: 92,849,290 probably null Het
Aen T A 7: 78,907,312 Y303N probably damaging Het
Alcam T C 16: 52,295,752 probably null Het
Apol7b A G 15: 77,425,546 L17P probably damaging Het
Cacna1c A T 6: 118,652,793 Y1058* probably null Het
Camk2d T C 3: 126,808,224 V354A probably benign Het
Carf T G 1: 60,124,858 M43R probably damaging Het
Casp8 T A 1: 58,824,124 F81Y probably damaging Het
Cd74 G A 18: 60,803,992 R20H probably benign Het
Cers5 A T 15: 99,745,931 Y16* probably null Het
Chuk A T 19: 44,078,958 M586K probably null Het
D130043K22Rik C A 13: 24,871,341 P496Q probably damaging Het
Dab2 A G 15: 6,429,938 R311G probably damaging Het
Diaph1 A T 18: 37,905,134 I48N unknown Het
Dnajc13 T C 9: 104,180,121 D1560G probably damaging Het
Dsg2 T C 18: 20,582,723 S241P probably damaging Het
Efcab5 T C 11: 77,105,378 D1119G probably benign Het
Efr3a G T 15: 65,869,057 probably benign Het
Evc2 A G 5: 37,393,083 K814E probably damaging Het
Gm5724 A G 6: 141,765,703 M94T probably benign Het
Hic2 A G 16: 17,258,822 D505G probably benign Het
Ing1 T A 8: 11,557,010 V34D probably damaging Het
Inpp5k A G 11: 75,637,491 M172V probably benign Het
Itgae T C 11: 73,115,592 V362A probably damaging Het
Lama2 T A 10: 27,187,754 R1346S probably damaging Het
Lrrc7 T C 3: 158,177,306 N450S probably damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Maml2 A T 9: 13,706,501 N381I probably damaging Het
Mettl15 T G 2: 109,092,921 E385D probably benign Het
Mthfr T A 4: 148,055,443 I623N possibly damaging Het
Muc4 A C 16: 32,753,020 N966T probably benign Het
Myoc A G 1: 162,648,996 Y423C probably damaging Het
Ncoa2 A T 1: 13,148,378 M1409K probably benign Het
Ncor2 T C 5: 125,109,975 probably benign Het
Numb T C 12: 83,797,259 E395G probably damaging Het
Oas1g A G 5: 120,881,949 F198S probably damaging Het
Olfr1367 T C 13: 21,347,024 V32A probably benign Het
Olfr181 A G 16: 58,925,686 V295A probably benign Het
Prdm13 T A 4: 21,678,909 Y527F probably damaging Het
Prr14l A G 5: 32,828,833 L1106P probably damaging Het
Ptbp1 T A 10: 79,863,273 I555N probably damaging Het
Ptchd4 A T 17: 42,503,715 T836S possibly damaging Het
Rlbp1 T C 7: 79,383,938 D3G probably benign Het
Sdk2 T C 11: 113,795,045 E1883G probably damaging Het
Serpinc1 A T 1: 160,993,404 K140N probably damaging Het
Serpind1 A T 16: 17,342,385 Y382F probably damaging Het
Slc28a3 T C 13: 58,563,106 E534G probably damaging Het
Ttyh2 T A 11: 114,710,179 I418N probably benign Het
Ugt2a2 A G 5: 87,464,106 L315P probably damaging Het
Vwa1 A T 4: 155,772,901 S147T probably damaging Het
Xylt1 T C 7: 117,591,952 V325A possibly damaging Het
Zfp335 T C 2: 164,899,456 H685R probably damaging Het
Other mutations in Tubgcp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Tubgcp4 APN 2 121178701 missense probably damaging 0.99
IGL01112:Tubgcp4 APN 2 121173601 missense probably benign 0.10
IGL01149:Tubgcp4 APN 2 121184783 missense probably null 0.01
IGL01869:Tubgcp4 APN 2 121175788 missense possibly damaging 0.95
IGL01873:Tubgcp4 APN 2 121188184 critical splice donor site probably null
IGL01888:Tubgcp4 APN 2 121184747 missense probably benign 0.15
IGL03060:Tubgcp4 APN 2 121176590 splice site probably benign
IGL03333:Tubgcp4 APN 2 121196173 unclassified probably null
FR4589:Tubgcp4 UTSW 2 121175463 critical splice donor site probably benign
G5030:Tubgcp4 UTSW 2 121184334 missense probably damaging 1.00
R0482:Tubgcp4 UTSW 2 121175374 missense probably benign 0.02
R0512:Tubgcp4 UTSW 2 121175419 missense probably benign 0.06
R1488:Tubgcp4 UTSW 2 121176550 missense possibly damaging 0.50
R1699:Tubgcp4 UTSW 2 121189893 nonsense probably null
R1760:Tubgcp4 UTSW 2 121189471 critical splice donor site probably null
R1935:Tubgcp4 UTSW 2 121178666 splice site probably benign
R2249:Tubgcp4 UTSW 2 121183629 missense possibly damaging 0.86
R4093:Tubgcp4 UTSW 2 121195477 missense probably benign 0.01
R4422:Tubgcp4 UTSW 2 121189401 nonsense probably null
R4433:Tubgcp4 UTSW 2 121184473 missense probably benign 0.01
R4541:Tubgcp4 UTSW 2 121195426 missense probably benign 0.01
R4670:Tubgcp4 UTSW 2 121173665 nonsense probably null
R4873:Tubgcp4 UTSW 2 121184849 intron probably benign
R4877:Tubgcp4 UTSW 2 121189862 missense probably benign
R5044:Tubgcp4 UTSW 2 121173580 missense probably damaging 1.00
R5436:Tubgcp4 UTSW 2 121188136 missense probably damaging 1.00
R5436:Tubgcp4 UTSW 2 121194182 missense probably benign 0.01
R5566:Tubgcp4 UTSW 2 121184770 missense possibly damaging 0.61
R6110:Tubgcp4 UTSW 2 121194108 missense probably benign 0.02
R6700:Tubgcp4 UTSW 2 121189848 missense probably benign 0.11
R6980:Tubgcp4 UTSW 2 121195465 missense probably benign 0.28
R6999:Tubgcp4 UTSW 2 121192297 missense probably damaging 1.00
R7338:Tubgcp4 UTSW 2 121193984 missense probably benign 0.02
R7388:Tubgcp4 UTSW 2 121189966 critical splice donor site probably null
R7410:Tubgcp4 UTSW 2 121184409 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGCACTTCTTTCCTGAGGCAC -3'
(R):5'- TTTGAAAACCGTACCCTCTAGCCAC -3'

Sequencing Primer
(F):5'- CCTGAGGCACCTTGCATAC -3'
(R):5'- CACGGGAAATAGCTCACTCTTAC -3'
Posted On2014-03-14