Incidental Mutation 'R1433:Prr14l'
ID 159299
Institutional Source Beutler Lab
Gene Symbol Prr14l
Ensembl Gene ENSMUSG00000054280
Gene Name proline rich 14-like
Synonyms
MMRRC Submission 039488-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock # R1433 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 32789820-32854256 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32828833 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1106 (L1106P)
Ref Sequence ENSEMBL: ENSMUSP00000113259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120129] [ENSMUST00000144673] [ENSMUST00000155392]
AlphaFold E9Q7C4
Predicted Effect probably damaging
Transcript: ENSMUST00000120129
AA Change: L1106P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113259
Gene: ENSMUSG00000054280
AA Change: L1106P

DomainStartEndE-ValueType
low complexity region 720 731 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
low complexity region 1471 1480 N/A INTRINSIC
Pfam:Tantalus 1838 1895 2.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144673
SMART Domains Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574

DomainStartEndE-ValueType
Pfam:Tantalus 158 193 1.2e-15 PFAM
Pfam:PS_Dcarbxylase 332 575 2.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155392
SMART Domains Protein: ENSMUSP00000119569
Gene: ENSMUSG00000054280

DomainStartEndE-ValueType
low complexity region 276 289 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
Meta Mutation Damage Score 0.0926 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A T 6: 116,652,262 S189C possibly damaging Het
Acp1 C T 12: 30,895,935 E140K possibly damaging Het
Acsm4 T A 7: 119,693,819 D57E probably damaging Het
Adamts9 A G 6: 92,849,290 probably null Het
Aen T A 7: 78,907,312 Y303N probably damaging Het
Alcam T C 16: 52,295,752 probably null Het
Apol7b A G 15: 77,425,546 L17P probably damaging Het
Cacna1c A T 6: 118,652,793 Y1058* probably null Het
Camk2d T C 3: 126,808,224 V354A probably benign Het
Carf T G 1: 60,124,858 M43R probably damaging Het
Casp8 T A 1: 58,824,124 F81Y probably damaging Het
Cd74 G A 18: 60,803,992 R20H probably benign Het
Cers5 A T 15: 99,745,931 Y16* probably null Het
Chuk A T 19: 44,078,958 M586K probably null Het
D130043K22Rik C A 13: 24,871,341 P496Q probably damaging Het
Dab2 A G 15: 6,429,938 R311G probably damaging Het
Diaph1 A T 18: 37,905,134 I48N unknown Het
Dnajc13 T C 9: 104,180,121 D1560G probably damaging Het
Dsg2 T C 18: 20,582,723 S241P probably damaging Het
Efcab5 T C 11: 77,105,378 D1119G probably benign Het
Efr3a G T 15: 65,869,057 probably benign Het
Evc2 A G 5: 37,393,083 K814E probably damaging Het
Gm5724 A G 6: 141,765,703 M94T probably benign Het
Hic2 A G 16: 17,258,822 D505G probably benign Het
Ing1 T A 8: 11,557,010 V34D probably damaging Het
Inpp5k A G 11: 75,637,491 M172V probably benign Het
Itgae T C 11: 73,115,592 V362A probably damaging Het
Lama2 T A 10: 27,187,754 R1346S probably damaging Het
Lrrc7 T C 3: 158,177,306 N450S probably damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Maml2 A T 9: 13,706,501 N381I probably damaging Het
Mettl15 T G 2: 109,092,921 E385D probably benign Het
Mthfr T A 4: 148,055,443 I623N possibly damaging Het
Muc4 A C 16: 32,753,020 N966T probably benign Het
Myoc A G 1: 162,648,996 Y423C probably damaging Het
Ncoa2 A T 1: 13,148,378 M1409K probably benign Het
Ncor2 T C 5: 125,109,975 probably benign Het
Numb T C 12: 83,797,259 E395G probably damaging Het
Oas1g A G 5: 120,881,949 F198S probably damaging Het
Olfr1367 T C 13: 21,347,024 V32A probably benign Het
Olfr181 A G 16: 58,925,686 V295A probably benign Het
Prdm13 T A 4: 21,678,909 Y527F probably damaging Het
Ptbp1 T A 10: 79,863,273 I555N probably damaging Het
Ptchd4 A T 17: 42,503,715 T836S possibly damaging Het
Rlbp1 T C 7: 79,383,938 D3G probably benign Het
Sdk2 T C 11: 113,795,045 E1883G probably damaging Het
Serpinc1 A T 1: 160,993,404 K140N probably damaging Het
Serpind1 A T 16: 17,342,385 Y382F probably damaging Het
Slc28a3 T C 13: 58,563,106 E534G probably damaging Het
Ttyh2 T A 11: 114,710,179 I418N probably benign Het
Tubgcp4 C T 2: 121,175,424 Q98* probably null Het
Ugt2a2 A G 5: 87,464,106 L315P probably damaging Het
Vwa1 A T 4: 155,772,901 S147T probably damaging Het
Xylt1 T C 7: 117,591,952 V325A possibly damaging Het
Zfp335 T C 2: 164,899,456 H685R probably damaging Het
Other mutations in Prr14l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Prr14l APN 5 32830676 missense probably benign 0.04
IGL00331:Prr14l APN 5 32831066 missense probably benign 0.02
IGL01571:Prr14l APN 5 32828806 missense probably benign 0.01
IGL01795:Prr14l APN 5 32831845 unclassified probably benign
IGL01929:Prr14l APN 5 32828243 missense probably benign 0.09
IGL01959:Prr14l APN 5 32830205 missense possibly damaging 0.84
IGL02139:Prr14l APN 5 32827532 missense probably damaging 1.00
IGL02321:Prr14l APN 5 32827807 missense probably benign 0.10
IGL02508:Prr14l APN 5 32830942 missense probably benign 0.01
IGL02551:Prr14l APN 5 32831484 missense probably damaging 1.00
IGL02585:Prr14l APN 5 32829484 missense possibly damaging 0.59
IGL02614:Prr14l APN 5 32830543 missense possibly damaging 0.76
IGL02808:Prr14l APN 5 32828182 missense possibly damaging 0.94
IGL02836:Prr14l APN 5 32831096 missense probably benign 0.42
IGL02952:Prr14l APN 5 32835670 missense unknown
IGL03034:Prr14l APN 5 32827438 missense possibly damaging 0.48
Polymer UTSW 5 32827145 missense probably benign 0.34
Postwar UTSW 5 32830684 missense probably benign 0.17
H8562:Prr14l UTSW 5 32793728 missense probably damaging 1.00
R0086:Prr14l UTSW 5 32831559 unclassified probably benign
R0149:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0333:Prr14l UTSW 5 32827993 missense probably damaging 1.00
R0361:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0416:Prr14l UTSW 5 32828717 missense probably benign 0.25
R0480:Prr14l UTSW 5 32829880 missense probably benign 0.02
R0511:Prr14l UTSW 5 32844216 intron probably benign
R0639:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0673:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0743:Prr14l UTSW 5 32831194 missense possibly damaging 0.55
R0792:Prr14l UTSW 5 32828423 missense probably damaging 1.00
R1006:Prr14l UTSW 5 32829482 missense probably benign 0.00
R1342:Prr14l UTSW 5 32830260 missense probably damaging 1.00
R1527:Prr14l UTSW 5 32827949 missense possibly damaging 0.75
R1704:Prr14l UTSW 5 32830282 missense probably benign 0.01
R1967:Prr14l UTSW 5 32844469 intron probably benign
R2129:Prr14l UTSW 5 32831828 unclassified probably benign
R2150:Prr14l UTSW 5 32830702 missense probably benign 0.14
R2318:Prr14l UTSW 5 32830078 missense probably benign 0.04
R2915:Prr14l UTSW 5 32829768 missense probably benign 0.04
R3551:Prr14l UTSW 5 32828619 splice site probably null
R3820:Prr14l UTSW 5 32828984 missense probably damaging 0.99
R3852:Prr14l UTSW 5 32830345 missense probably damaging 1.00
R4126:Prr14l UTSW 5 32828003 missense probably damaging 0.97
R4345:Prr14l UTSW 5 32828576 missense probably damaging 1.00
R4388:Prr14l UTSW 5 32829254 missense probably damaging 1.00
R4575:Prr14l UTSW 5 32793644 missense probably damaging 1.00
R4596:Prr14l UTSW 5 32829308 missense probably benign 0.01
R4690:Prr14l UTSW 5 32844156 intron probably benign
R4824:Prr14l UTSW 5 32844399 intron probably benign
R4868:Prr14l UTSW 5 32829937 missense probably benign 0.04
R4869:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R5201:Prr14l UTSW 5 32830247 missense possibly damaging 0.52
R5328:Prr14l UTSW 5 32830021 missense probably benign 0.00
R5410:Prr14l UTSW 5 32827777 missense probably damaging 0.98
R5476:Prr14l UTSW 5 32844138 intron probably benign
R5623:Prr14l UTSW 5 32844508 intron probably benign
R5730:Prr14l UTSW 5 32793603 missense probably damaging 1.00
R5988:Prr14l UTSW 5 32830851 missense probably damaging 0.98
R6261:Prr14l UTSW 5 32829404 missense possibly damaging 0.46
R6283:Prr14l UTSW 5 32830264 missense probably benign 0.14
R6307:Prr14l UTSW 5 32827525 missense probably damaging 0.97
R6825:Prr14l UTSW 5 32828548 missense possibly damaging 0.86
R6862:Prr14l UTSW 5 32827759 missense probably damaging 1.00
R6880:Prr14l UTSW 5 32830867 missense probably benign 0.01
R6931:Prr14l UTSW 5 32830691 missense probably damaging 0.98
R7101:Prr14l UTSW 5 32829427 missense probably damaging 1.00
R7164:Prr14l UTSW 5 32829166 missense probably damaging 1.00
R7203:Prr14l UTSW 5 32827145 missense probably benign 0.34
R7211:Prr14l UTSW 5 32830087 missense probably damaging 0.98
R7305:Prr14l UTSW 5 32831101 missense probably benign 0.14
R7346:Prr14l UTSW 5 32830684 missense probably benign 0.17
R7395:Prr14l UTSW 5 32828638 missense probably benign 0.00
R7624:Prr14l UTSW 5 32829623 missense possibly damaging 0.54
R7649:Prr14l UTSW 5 32828245 missense probably benign 0.18
R7753:Prr14l UTSW 5 32827253 missense probably damaging 1.00
R7828:Prr14l UTSW 5 32844391 intron probably benign
R7898:Prr14l UTSW 5 32829966 missense probably benign 0.04
R8071:Prr14l UTSW 5 32831164 missense probably benign 0.02
R9052:Prr14l UTSW 5 32830134 nonsense probably null
R9136:Prr14l UTSW 5 32828736 missense
Predicted Primers PCR Primer
(F):5'- ACAGGTATGTGACCCAGTAGTCCAG -3'
(R):5'- GAAGACTGTCCAGACTCTGCCATTG -3'

Sequencing Primer
(F):5'- ACCCAGTAGTCCAGTCTGATG -3'
(R):5'- CAGACTCTGCCATTGATCATGAAG -3'
Posted On 2014-03-14