Incidental Mutation 'R1433:Acsm4'
ID159317
Institutional Source Beutler Lab
Gene Symbol Acsm4
Ensembl Gene ENSMUSG00000047026
Gene Nameacyl-CoA synthetase medium-chain family member 4
SynonymsOMACS, O-MACS
MMRRC Submission 039488-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1433 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location119690026-119714565 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119693819 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 57 (D57E)
Ref Sequence ENSEMBL: ENSMUSP00000045160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047045]
Predicted Effect probably damaging
Transcript: ENSMUST00000047045
AA Change: D57E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045160
Gene: ENSMUSG00000047026
AA Change: D57E

DomainStartEndE-ValueType
Pfam:AMP-binding 64 478 5.8e-83 PFAM
Pfam:AMP-binding_C 486 566 1.4e-22 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A T 6: 116,652,262 S189C possibly damaging Het
Acp1 C T 12: 30,895,935 E140K possibly damaging Het
Adamts9 A G 6: 92,849,290 probably null Het
Aen T A 7: 78,907,312 Y303N probably damaging Het
Alcam T C 16: 52,295,752 probably null Het
Apol7b A G 15: 77,425,546 L17P probably damaging Het
Cacna1c A T 6: 118,652,793 Y1058* probably null Het
Camk2d T C 3: 126,808,224 V354A probably benign Het
Carf T G 1: 60,124,858 M43R probably damaging Het
Casp8 T A 1: 58,824,124 F81Y probably damaging Het
Cd74 G A 18: 60,803,992 R20H probably benign Het
Cers5 A T 15: 99,745,931 Y16* probably null Het
Chuk A T 19: 44,078,958 M586K probably null Het
D130043K22Rik C A 13: 24,871,341 P496Q probably damaging Het
Dab2 A G 15: 6,429,938 R311G probably damaging Het
Diaph1 A T 18: 37,905,134 I48N unknown Het
Dnajc13 T C 9: 104,180,121 D1560G probably damaging Het
Dsg2 T C 18: 20,582,723 S241P probably damaging Het
Efcab5 T C 11: 77,105,378 D1119G probably benign Het
Efr3a G T 15: 65,869,057 probably benign Het
Evc2 A G 5: 37,393,083 K814E probably damaging Het
Gm5724 A G 6: 141,765,703 M94T probably benign Het
Hic2 A G 16: 17,258,822 D505G probably benign Het
Ing1 T A 8: 11,557,010 V34D probably damaging Het
Inpp5k A G 11: 75,637,491 M172V probably benign Het
Itgae T C 11: 73,115,592 V362A probably damaging Het
Lama2 T A 10: 27,187,754 R1346S probably damaging Het
Lrrc7 T C 3: 158,177,306 N450S probably damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Maml2 A T 9: 13,706,501 N381I probably damaging Het
Mettl15 T G 2: 109,092,921 E385D probably benign Het
Mthfr T A 4: 148,055,443 I623N possibly damaging Het
Muc4 A C 16: 32,753,020 N966T probably benign Het
Myoc A G 1: 162,648,996 Y423C probably damaging Het
Ncoa2 A T 1: 13,148,378 M1409K probably benign Het
Ncor2 T C 5: 125,109,975 probably benign Het
Numb T C 12: 83,797,259 E395G probably damaging Het
Oas1g A G 5: 120,881,949 F198S probably damaging Het
Olfr1367 T C 13: 21,347,024 V32A probably benign Het
Olfr181 A G 16: 58,925,686 V295A probably benign Het
Prdm13 T A 4: 21,678,909 Y527F probably damaging Het
Prr14l A G 5: 32,828,833 L1106P probably damaging Het
Ptbp1 T A 10: 79,863,273 I555N probably damaging Het
Ptchd4 A T 17: 42,503,715 T836S possibly damaging Het
Rlbp1 T C 7: 79,383,938 D3G probably benign Het
Sdk2 T C 11: 113,795,045 E1883G probably damaging Het
Serpinc1 A T 1: 160,993,404 K140N probably damaging Het
Serpind1 A T 16: 17,342,385 Y382F probably damaging Het
Slc28a3 T C 13: 58,563,106 E534G probably damaging Het
Ttyh2 T A 11: 114,710,179 I418N probably benign Het
Tubgcp4 C T 2: 121,175,424 Q98* probably null Het
Ugt2a2 A G 5: 87,464,106 L315P probably damaging Het
Vwa1 A T 4: 155,772,901 S147T probably damaging Het
Xylt1 T C 7: 117,591,952 V325A possibly damaging Het
Zfp335 T C 2: 164,899,456 H685R probably damaging Het
Other mutations in Acsm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Acsm4 APN 7 119711419 nonsense probably null
IGL01676:Acsm4 APN 7 119708643 missense probably benign 0.00
IGL01801:Acsm4 APN 7 119707263 missense possibly damaging 0.80
IGL02183:Acsm4 APN 7 119693852 splice site probably null
IGL02220:Acsm4 APN 7 119711172 missense probably damaging 1.00
IGL02637:Acsm4 APN 7 119710684 missense probably damaging 1.00
IGL03290:Acsm4 APN 7 119703423 splice site probably benign
I0000:Acsm4 UTSW 7 119711192 missense probably damaging 1.00
PIT4382001:Acsm4 UTSW 7 119698575 missense probably damaging 1.00
R1068:Acsm4 UTSW 7 119708710 missense probably benign 0.00
R1386:Acsm4 UTSW 7 119698578 missense probably benign
R1961:Acsm4 UTSW 7 119708740 missense probably benign 0.04
R3957:Acsm4 UTSW 7 119703365 missense possibly damaging 0.93
R4029:Acsm4 UTSW 7 119693785 missense probably benign
R4072:Acsm4 UTSW 7 119698758 missense probably benign 0.14
R4075:Acsm4 UTSW 7 119698758 missense probably benign 0.14
R4076:Acsm4 UTSW 7 119698758 missense probably benign 0.14
R4432:Acsm4 UTSW 7 119711387 missense probably damaging 1.00
R4452:Acsm4 UTSW 7 119698574 missense possibly damaging 0.92
R4757:Acsm4 UTSW 7 119698677 missense probably benign
R4992:Acsm4 UTSW 7 119711417 missense probably benign 0.43
R5046:Acsm4 UTSW 7 119703374 missense probably damaging 0.99
R5473:Acsm4 UTSW 7 119712950 missense probably damaging 1.00
R5662:Acsm4 UTSW 7 119694800 missense possibly damaging 0.49
R5780:Acsm4 UTSW 7 119693845 missense possibly damaging 0.66
R6957:Acsm4 UTSW 7 119711399 missense probably damaging 1.00
R7579:Acsm4 UTSW 7 119693710 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGGAATCCACTCCCAGTCTTCAG -3'
(R):5'- TGAGTCTCCATGAAGCCATCCAGG -3'

Sequencing Primer
(F):5'- TTTCAGGAACCATGAAGGTTCTCC -3'
(R):5'- AAGCCATCCAGGTTCCTGC -3'
Posted On2014-03-14