Mutagenetix > Incidental Mutation

Incidental Mutation 'R1433:Itgae'

159324

Institutional Source

Beutler Lab

Gene Symbol

Itgae

Ensembl Gene

ENSMUSG00000005947

Gene Name

integrin alpha E, epithelial-associated

Synonyms

CD103, alpha-E1

MMRRC Submission

039488-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1433 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73090583-73147446 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 73115592 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 362 (V362A)

Ref Sequence

ENSEMBL: ENSMUSP00000099596 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]

AlphaFold

Q60677

Predicted Effect

probably damaging
Transcript: ENSMUST00000006101
AA Change: V362A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: V362A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	1e-24	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART
transmembrane domain	1115	1137	N/A	INTRINSIC
Pfam:Integrin_alpha	1138	1152	1.1e-6	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102537
AA Change: V362A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: V362A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	5e-25	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 94.8%
20x: 87.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8430408G22Rik	A	T	6: 116,652,262	S189C	possibly damaging	Het
Acp1	C	T	12: 30,895,935	E140K	possibly damaging	Het
Acsm4	T	A	7: 119,693,819	D57E	probably damaging	Het
Adamts9	A	G	6: 92,849,290		probably null	Het
Aen	T	A	7: 78,907,312	Y303N	probably damaging	Het
Alcam	T	C	16: 52,295,752		probably null	Het
Apol7b	A	G	15: 77,425,546	L17P	probably damaging	Het
Cacna1c	A	T	6: 118,652,793	Y1058*	probably null	Het
Camk2d	T	C	3: 126,808,224	V354A	probably benign	Het
Carf	T	G	1: 60,124,858	M43R	probably damaging	Het
Casp8	T	A	1: 58,824,124	F81Y	probably damaging	Het
Cd74	G	A	18: 60,803,992	R20H	probably benign	Het
Cers5	A	T	15: 99,745,931	Y16*	probably null	Het
Chuk	A	T	19: 44,078,958	M586K	probably null	Het
D130043K22Rik	C	A	13: 24,871,341	P496Q	probably damaging	Het
Dab2	A	G	15: 6,429,938	R311G	probably damaging	Het
Diaph1	A	T	18: 37,905,134	I48N	unknown	Het
Dnajc13	T	C	9: 104,180,121	D1560G	probably damaging	Het
Dsg2	T	C	18: 20,582,723	S241P	probably damaging	Het
Efcab5	T	C	11: 77,105,378	D1119G	probably benign	Het
Efr3a	G	T	15: 65,869,057		probably benign	Het
Evc2	A	G	5: 37,393,083	K814E	probably damaging	Het
Gm5724	A	G	6: 141,765,703	M94T	probably benign	Het
Hic2	A	G	16: 17,258,822	D505G	probably benign	Het
Ing1	T	A	8: 11,557,010	V34D	probably damaging	Het
Inpp5k	A	G	11: 75,637,491	M172V	probably benign	Het
Lama2	T	A	10: 27,187,754	R1346S	probably damaging	Het
Lrrc7	T	C	3: 158,177,306	N450S	probably damaging	Het
Lrrn3	T	A	12: 41,452,584	Y578F	possibly damaging	Het
Maml2	A	T	9: 13,706,501	N381I	probably damaging	Het
Mettl15	T	G	2: 109,092,921	E385D	probably benign	Het
Mthfr	T	A	4: 148,055,443	I623N	possibly damaging	Het
Muc4	A	C	16: 32,753,020	N966T	probably benign	Het
Myoc	A	G	1: 162,648,996	Y423C	probably damaging	Het
Ncoa2	A	T	1: 13,148,378	M1409K	probably benign	Het
Ncor2	T	C	5: 125,109,975		probably benign	Het
Numb	T	C	12: 83,797,259	E395G	probably damaging	Het
Oas1g	A	G	5: 120,881,949	F198S	probably damaging	Het
Olfr1367	T	C	13: 21,347,024	V32A	probably benign	Het
Olfr181	A	G	16: 58,925,686	V295A	probably benign	Het
Prdm13	T	A	4: 21,678,909	Y527F	probably damaging	Het
Prr14l	A	G	5: 32,828,833	L1106P	probably damaging	Het
Ptbp1	T	A	10: 79,863,273	I555N	probably damaging	Het
Ptchd4	A	T	17: 42,503,715	T836S	possibly damaging	Het
Rlbp1	T	C	7: 79,383,938	D3G	probably benign	Het
Sdk2	T	C	11: 113,795,045	E1883G	probably damaging	Het
Serpinc1	A	T	1: 160,993,404	K140N	probably damaging	Het
Serpind1	A	T	16: 17,342,385	Y382F	probably damaging	Het
Slc28a3	T	C	13: 58,563,106	E534G	probably damaging	Het
Ttyh2	T	A	11: 114,710,179	I418N	probably benign	Het
Tubgcp4	C	T	2: 121,175,424	Q98*	probably null	Het
Ugt2a2	A	G	5: 87,464,106	L315P	probably damaging	Het
Vwa1	A	T	4: 155,772,901	S147T	probably damaging	Het
Xylt1	T	C	7: 117,591,952	V325A	possibly damaging	Het
Zfp335	T	C	2: 164,899,456	H685R	probably damaging	Het

Other mutations in Itgae

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Itgae	APN	11	73145635	missense	probably benign	0.17
IGL00472:Itgae	APN	11	73113694	missense	probably benign	0.06
IGL00821:Itgae	APN	11	73123148	missense	probably damaging	1.00
IGL01625:Itgae	APN	11	73119437	missense	probably benign	0.00
IGL01639:Itgae	APN	11	73119378	missense	probably benign	0.00
IGL01743:Itgae	APN	11	73111759	missense	probably benign	0.02
IGL01911:Itgae	APN	11	73116137	missense	probably damaging	1.00
IGL01949:Itgae	APN	11	73118184	missense	probably benign	0.29
IGL02149:Itgae	APN	11	73103894	missense	probably benign	0.04
IGL02179:Itgae	APN	11	73134018	missense	probably benign	0.06
IGL02231:Itgae	APN	11	73090622	missense	possibly damaging	0.88
IGL02292:Itgae	APN	11	73118535	missense	probably damaging	0.98
IGL02378:Itgae	APN	11	73118121	missense	probably benign	0.00
IGL02525:Itgae	APN	11	73130951	missense	probably damaging	0.98
IGL02576:Itgae	APN	11	73118505	missense	possibly damaging	0.95
IGL02729:Itgae	APN	11	73118203	splice site	probably benign
IGL02859:Itgae	APN	11	73114867	missense	probably damaging	1.00
IGL03074:Itgae	APN	11	73125310	missense	probably benign	0.00
IGL03107:Itgae	APN	11	73113601	missense	probably damaging	1.00
IGL03264:Itgae	APN	11	73115574	missense	possibly damaging	0.73
IGL03272:Itgae	APN	11	73133854	splice site	probably null
IGL03352:Itgae	APN	11	73131730	missense	probably damaging	1.00
R0134:Itgae	UTSW	11	73111342	missense	probably benign	0.00
R0225:Itgae	UTSW	11	73111342	missense	probably benign	0.00
R0320:Itgae	UTSW	11	73130999	missense	possibly damaging	0.74
R0344:Itgae	UTSW	11	73118147	missense	probably benign	0.13
R0403:Itgae	UTSW	11	73123183	missense	possibly damaging	0.89
R0631:Itgae	UTSW	11	73114907	missense	probably damaging	1.00
R0833:Itgae	UTSW	11	73129206	missense	probably benign	0.02
R0836:Itgae	UTSW	11	73129206	missense	probably benign	0.02
R0973:Itgae	UTSW	11	73138509	nonsense	probably null
R1231:Itgae	UTSW	11	73119379	missense	probably benign	0.02
R1389:Itgae	UTSW	11	73125362	missense	probably damaging	1.00
R1534:Itgae	UTSW	11	73145605	missense	possibly damaging	0.58
R1833:Itgae	UTSW	11	73117162	missense	possibly damaging	0.94
R1914:Itgae	UTSW	11	73118643	splice site	probably benign
R1915:Itgae	UTSW	11	73118643	splice site	probably benign
R2061:Itgae	UTSW	11	73118622	missense	probably benign	0.00
R2380:Itgae	UTSW	11	73145569	missense	probably benign	0.00
R2435:Itgae	UTSW	11	73121937	nonsense	probably null
R2680:Itgae	UTSW	11	73114926	missense	probably damaging	1.00
R2886:Itgae	UTSW	11	73140687	missense	probably benign	0.04
R3873:Itgae	UTSW	11	73113616	missense	probably damaging	1.00
R3923:Itgae	UTSW	11	73116143	missense	probably damaging	0.99
R4010:Itgae	UTSW	11	73111339	missense	probably benign	0.00
R4059:Itgae	UTSW	11	73112134	missense	probably benign
R4212:Itgae	UTSW	11	73119352	missense	probably benign
R4213:Itgae	UTSW	11	73119352	missense	probably benign
R4691:Itgae	UTSW	11	73119519	nonsense	probably null
R4736:Itgae	UTSW	11	73114880	missense	possibly damaging	0.79
R5152:Itgae	UTSW	11	73130995	missense	probably damaging	1.00
R5201:Itgae	UTSW	11	73110556	missense	probably benign	0.00
R5307:Itgae	UTSW	11	73145638	missense	probably benign	0.00
R5362:Itgae	UTSW	11	73111849	missense	probably damaging	1.00
R5448:Itgae	UTSW	11	73133908	critical splice donor site	probably null
R5645:Itgae	UTSW	11	73129248	missense	probably damaging	1.00
R5672:Itgae	UTSW	11	73145551	missense	possibly damaging	0.96
R6079:Itgae	UTSW	11	73115574	missense	possibly damaging	0.73
R6138:Itgae	UTSW	11	73115574	missense	possibly damaging	0.73
R6226:Itgae	UTSW	11	73140757	missense	probably benign	0.11
R6244:Itgae	UTSW	11	73145601	missense	probably damaging	0.96
R6326:Itgae	UTSW	11	73131693	missense	possibly damaging	0.88
R6332:Itgae	UTSW	11	73111402	splice site	probably null
R6502:Itgae	UTSW	11	73145592	missense	probably benign	0.10
R6825:Itgae	UTSW	11	73118496	missense	possibly damaging	0.89
R7016:Itgae	UTSW	11	73119516	missense	probably damaging	0.99
R7020:Itgae	UTSW	11	73111369	missense	probably damaging	1.00
R7069:Itgae	UTSW	11	73116143	missense	probably damaging	0.99
R7132:Itgae	UTSW	11	73111358	missense	possibly damaging	0.93
R7473:Itgae	UTSW	11	73140678	missense	possibly damaging	0.87
R7599:Itgae	UTSW	11	73121960	missense	possibly damaging	0.62
R7637:Itgae	UTSW	11	73113631	missense	probably damaging	1.00
R7763:Itgae	UTSW	11	73123269	critical splice donor site	probably null
R7829:Itgae	UTSW	11	73138792	missense	probably benign
R7860:Itgae	UTSW	11	73120273	critical splice acceptor site	probably null
R7978:Itgae	UTSW	11	73134087	missense	probably damaging	0.98
R8197:Itgae	UTSW	11	73120384	missense	probably benign
R8911:Itgae	UTSW	11	73113621	missense	probably damaging	1.00
R9155:Itgae	UTSW	11	73125263	missense	possibly damaging	0.94
R9284:Itgae	UTSW	11	73121926	missense	probably benign	0.25
R9355:Itgae	UTSW	11	73116080	missense	probably damaging	1.00
R9414:Itgae	UTSW	11	73111803	missense	possibly damaging	0.59
R9595:Itgae	UTSW	11	73125356	missense	probably damaging	0.99
R9618:Itgae	UTSW	11	73120345	missense	possibly damaging	0.78
U15987:Itgae	UTSW	11	73115574	missense	possibly damaging	0.73
X0024:Itgae	UTSW	11	73111376	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1186:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1186:Itgae	UTSW	11	73115640	missense	probably benign
Z1186:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1187:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1187:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1187:Itgae	UTSW	11	73115640	missense	probably benign
Z1187:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1187:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1188:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1188:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1188:Itgae	UTSW	11	73115640	missense	probably benign
Z1188:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1188:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1189:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1189:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1189:Itgae	UTSW	11	73115640	missense	probably benign
Z1189:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1189:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1190:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1190:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1190:Itgae	UTSW	11	73115640	missense	probably benign
Z1190:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1190:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1191:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1191:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1191:Itgae	UTSW	11	73115640	missense	probably benign
Z1191:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1191:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1192:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1192:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1192:Itgae	UTSW	11	73115640	missense	probably benign
Z1192:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1192:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73134127	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- GTCAGGAACACATTGCCAAAAGTGG -3'
(R):5'- TCAGCAGAGCTTCATAGAGTCAGGG -3'

Sequencing Primer
(F):5'- agaaaggaaagagggagaggaag -3'
(R):5'- CTTCATAGAGTCAGGGAGGGG -3'

Posted On

2014-03-14