Incidental Mutation 'R1433:Ptchd4'
ID159347
Institutional Source Beutler Lab
Gene Symbol Ptchd4
Ensembl Gene ENSMUSG00000042256
Gene Namepatched domain containing 4
Synonyms3110082D06Rik
MMRRC Submission 039488-MU
Accession Numbers

Ncbi RefSeq: NM_028474.1; MGI: 1920485

Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1433 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location42315947-42507741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42503715 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 836 (T836S)
Ref Sequence ENSEMBL: ENSMUSP00000047640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048691]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048691
AA Change: T836S

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047640
Gene: ENSMUSG00000042256
AA Change: T836S

DomainStartEndE-ValueType
Pfam:Patched 58 867 6.1e-102 PFAM
Pfam:Sterol-sensing 312 464 2.9e-26 PFAM
low complexity region 869 891 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A T 6: 116,652,262 S189C possibly damaging Het
Acp1 C T 12: 30,895,935 E140K possibly damaging Het
Acsm4 T A 7: 119,693,819 D57E probably damaging Het
Adamts9 A G 6: 92,849,290 probably null Het
Aen T A 7: 78,907,312 Y303N probably damaging Het
Alcam T C 16: 52,295,752 probably null Het
Apol7b A G 15: 77,425,546 L17P probably damaging Het
Cacna1c A T 6: 118,652,793 Y1058* probably null Het
Camk2d T C 3: 126,808,224 V354A probably benign Het
Carf T G 1: 60,124,858 M43R probably damaging Het
Casp8 T A 1: 58,824,124 F81Y probably damaging Het
Cd74 G A 18: 60,803,992 R20H probably benign Het
Cers5 A T 15: 99,745,931 Y16* probably null Het
Chuk A T 19: 44,078,958 M586K probably null Het
D130043K22Rik C A 13: 24,871,341 P496Q probably damaging Het
Dab2 A G 15: 6,429,938 R311G probably damaging Het
Diaph1 A T 18: 37,905,134 I48N unknown Het
Dnajc13 T C 9: 104,180,121 D1560G probably damaging Het
Dsg2 T C 18: 20,582,723 S241P probably damaging Het
Efcab5 T C 11: 77,105,378 D1119G probably benign Het
Efr3a G T 15: 65,869,057 probably benign Het
Evc2 A G 5: 37,393,083 K814E probably damaging Het
Gm5724 A G 6: 141,765,703 M94T probably benign Het
Hic2 A G 16: 17,258,822 D505G probably benign Het
Ing1 T A 8: 11,557,010 V34D probably damaging Het
Inpp5k A G 11: 75,637,491 M172V probably benign Het
Itgae T C 11: 73,115,592 V362A probably damaging Het
Lama2 T A 10: 27,187,754 R1346S probably damaging Het
Lrrc7 T C 3: 158,177,306 N450S probably damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Maml2 A T 9: 13,706,501 N381I probably damaging Het
Mettl15 T G 2: 109,092,921 E385D probably benign Het
Mthfr T A 4: 148,055,443 I623N possibly damaging Het
Muc4 A C 16: 32,753,020 N966T probably benign Het
Myoc A G 1: 162,648,996 Y423C probably damaging Het
Ncoa2 A T 1: 13,148,378 M1409K probably benign Het
Ncor2 T C 5: 125,109,975 probably benign Het
Numb T C 12: 83,797,259 E395G probably damaging Het
Oas1g A G 5: 120,881,949 F198S probably damaging Het
Olfr1367 T C 13: 21,347,024 V32A probably benign Het
Olfr181 A G 16: 58,925,686 V295A probably benign Het
Prdm13 T A 4: 21,678,909 Y527F probably damaging Het
Prr14l A G 5: 32,828,833 L1106P probably damaging Het
Ptbp1 T A 10: 79,863,273 I555N probably damaging Het
Rlbp1 T C 7: 79,383,938 D3G probably benign Het
Sdk2 T C 11: 113,795,045 E1883G probably damaging Het
Serpinc1 A T 1: 160,993,404 K140N probably damaging Het
Serpind1 A T 16: 17,342,385 Y382F probably damaging Het
Slc28a3 T C 13: 58,563,106 E534G probably damaging Het
Ttyh2 T A 11: 114,710,179 I418N probably benign Het
Tubgcp4 C T 2: 121,175,424 Q98* probably null Het
Ugt2a2 A G 5: 87,464,106 L315P probably damaging Het
Vwa1 A T 4: 155,772,901 S147T probably damaging Het
Xylt1 T C 7: 117,591,952 V325A possibly damaging Het
Zfp335 T C 2: 164,899,456 H685R probably damaging Het
Other mutations in Ptchd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ptchd4 APN 17 42316926 nonsense probably null
IGL01360:Ptchd4 APN 17 42317045 missense probably benign 0.09
IGL01814:Ptchd4 APN 17 42503286 missense possibly damaging 0.84
IGL01885:Ptchd4 APN 17 42503602 missense probably damaging 1.00
IGL01929:Ptchd4 APN 17 42503322 missense probably benign 0.02
IGL02371:Ptchd4 APN 17 42316974 missense possibly damaging 0.83
IGL02480:Ptchd4 APN 17 42502540 missense probably benign 0.38
IGL02507:Ptchd4 APN 17 42316873 missense possibly damaging 0.72
IGL02593:Ptchd4 APN 17 42317146 missense probably benign 0.24
IGL02861:Ptchd4 APN 17 42377317 missense probably damaging 1.00
IGL02884:Ptchd4 APN 17 42502449 missense possibly damaging 0.86
IGL03384:Ptchd4 APN 17 42502590 missense probably damaging 1.00
PIT4418001:Ptchd4 UTSW 17 42503089 missense probably damaging 1.00
R0030:Ptchd4 UTSW 17 42317108 nonsense probably null
R0243:Ptchd4 UTSW 17 42503416 missense probably damaging 1.00
R0398:Ptchd4 UTSW 17 42377259 missense possibly damaging 0.95
R0513:Ptchd4 UTSW 17 42503746 missense probably benign 0.14
R0630:Ptchd4 UTSW 17 42377185 missense probably benign 0.17
R0662:Ptchd4 UTSW 17 42502576 missense probably damaging 1.00
R1004:Ptchd4 UTSW 17 42377602 missense probably benign 0.00
R1451:Ptchd4 UTSW 17 42502918 missense probably damaging 0.99
R1522:Ptchd4 UTSW 17 42503542 missense probably damaging 1.00
R1901:Ptchd4 UTSW 17 42503616 missense probably benign 0.10
R1902:Ptchd4 UTSW 17 42503616 missense probably benign 0.10
R2135:Ptchd4 UTSW 17 42317074 missense probably benign 0.01
R3935:Ptchd4 UTSW 17 42503489 missense possibly damaging 0.80
R4184:Ptchd4 UTSW 17 42502759 missense probably damaging 0.99
R4552:Ptchd4 UTSW 17 42502455 missense probably benign 0.00
R4573:Ptchd4 UTSW 17 42502777 missense probably benign 0.26
R5100:Ptchd4 UTSW 17 42503676 missense possibly damaging 0.59
R5640:Ptchd4 UTSW 17 42503135 missense possibly damaging 0.73
R6213:Ptchd4 UTSW 17 42377360 missense probably benign 0.00
R6704:Ptchd4 UTSW 17 42317040 missense probably benign 0.00
R7011:Ptchd4 UTSW 17 42503868 missense probably benign 0.19
R7017:Ptchd4 UTSW 17 42502735 missense probably damaging 1.00
R7185:Ptchd4 UTSW 17 42503188 missense probably damaging 1.00
R8112:Ptchd4 UTSW 17 42503175 missense probably benign 0.25
R8153:Ptchd4 UTSW 17 42503896 missense probably benign 0.31
R8220:Ptchd4 UTSW 17 42502663 missense probably benign 0.00
X0062:Ptchd4 UTSW 17 42377464 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTTTGTCAGTCACTGTGCCTGTTC -3'
(R):5'- GCCTTACTAGCCCTGCATCATTGTG -3'

Sequencing Primer
(F):5'- TAGTGATCCATCCTCTGGGAAAC -3'
(R):5'- ACCCTCAGACTGTGGTGAC -3'
Posted On2014-03-14