Mutagenetix > Incidental Mutations

Incidental Mutation 'R1434:Kcnd2'

159376

Institutional Source

Beutler Lab

Gene Symbol

Kcnd2

Ensembl Gene

ENSMUSG00000060882

Gene Name

potassium voltage-gated channel, Shal-related family, member 2

Synonyms

Kv4.2

MMRRC Submission

039489-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R1434 (G1)

Quality Score

110

Status

Validated

Chromosome

Chromosomal Location

21215503-21729805 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 21216357 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 20 (M20K)

Ref Sequence

ENSEMBL: ENSMUSP00000080257 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081542]

Predicted Effect

probably damaging
Transcript: ENSMUST00000081542
AA Change: M20K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882
AA Change: M20K

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	4.5e-16	PFAM
BTB	41	140	3.42e-14	SMART
Pfam:Ion_trans	184	417	1.4e-44	PFAM
Pfam:Ion_trans_2	330	411	5.5e-15	PFAM
low complexity region	418	437	N/A	INTRINSIC
Pfam:DUF3399	445	546	5.5e-44	PFAM
low complexity region	594	608	N/A	INTRINSIC

Meta Mutation Damage Score

0.3006

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.4%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4430402I18Rik	G	T	19: 28,927,639		probably benign	Het
Abca12	G	T	1: 71,309,800	H851N	probably benign	Het
Adamtsl4	T	C	3: 95,680,784	Y631C	probably damaging	Het
Ankhd1	A	G	18: 36,625,159	I969V	probably benign	Het
Apob	A	G	12: 8,009,715	I2699M	probably damaging	Het
Aqr	A	T	2: 114,150,409	L297Q	probably damaging	Het
BC067074	G	A	13: 113,368,492	V510I	possibly damaging	Het
Camsap1	A	G	2: 25,945,178	Y301H	probably damaging	Het
Ccdc88c	A	G	12: 100,939,166		probably benign	Het
Cd209b	T	A	8: 3,923,367	I106F	possibly damaging	Het
Cdkn1b	T	A	6: 134,921,097	W60R	probably damaging	Het
Coasy	A	G	11: 101,084,996		probably benign	Het
Col2a1	T	A	15: 97,979,651	Q1017L	probably damaging	Het
Ctnnal1	T	A	4: 56,847,971	N56I	probably damaging	Het
Cyb561d2	T	A	9: 107,541,643		probably benign	Het
Dcst1	G	T	3: 89,352,519	T632N	probably damaging	Het
Ddx1	C	T	12: 13,237,231	V267I	probably benign	Het
Dnah10	A	T	5: 124,774,986	M1736L	probably benign	Het
Eln	G	A	5: 134,729,437		probably benign	Het
Enpp2	A	T	15: 54,862,681	D566E	probably damaging	Het
Ezh1	T	C	11: 101,194,917	K638R	probably damaging	Het
Fam172a	A	T	13: 77,761,922	Y98F	probably damaging	Het
Fdx1l	C	A	9: 21,073,398	G37W	probably benign	Het
Grin2b	T	C	6: 135,843,195	I340V	probably benign	Het
Ikbkap	T	A	4: 56,781,193	E493D	probably benign	Het
Il16	T	C	7: 83,655,312	T671A	probably benign	Het
Kndc1	C	T	7: 139,922,684	S962F	probably damaging	Het
L1td1	A	G	4: 98,737,817	S750G	possibly damaging	Het
Lama2	A	G	10: 27,208,370	C935R	probably damaging	Het
Lgalsl	T	C	11: 20,826,418	D158G	possibly damaging	Het
Lman1	A	T	18: 65,993,073		probably null	Het
Lmtk2	A	G	5: 144,174,589	E709G	probably damaging	Het
Lrfn3	T	C	7: 30,355,927	H531R	possibly damaging	Het
Mark3	A	G	12: 111,623,325		probably benign	Het
Mov10	T	C	3: 104,795,174	E997G	probably damaging	Het
Myo15	T	A	11: 60,504,331	W2484R	probably benign	Het
Myo1g	G	T	11: 6,509,372	Q833K	probably benign	Het
Ncoa3	T	A	2: 166,055,510	D740E	probably benign	Het
Nol12	A	G	15: 78,937,953		probably benign	Het
Nrxn2	T	A	19: 6,443,612		probably null	Het
Nsfl1c	A	C	2: 151,500,746	I79L	probably benign	Het
Olfr1462	A	G	19: 13,191,298	I210M	probably benign	Het
Olfr173	G	T	16: 58,797,448	H133N	probably benign	Het
Olfr691	T	C	7: 105,337,261	I152V	probably benign	Het
Osbpl8	A	C	10: 111,291,581	E842A	probably benign	Het
Pdxk	G	T	10: 78,440,811	T310K	probably benign	Het
Phip	T	G	9: 82,959,605	K54Q	probably damaging	Het
Pklr	A	T	3: 89,143,035	D366V	probably damaging	Het
Plxna2	T	A	1: 194,751,540		probably benign	Het
Ppp4r3a	A	T	12: 101,043,524	V618E	probably damaging	Het
Prdm12	A	T	2: 31,640,307	Q70L	possibly damaging	Het
Ptpn21	A	T	12: 98,688,590	M706K	probably damaging	Het
Ptprq	A	T	10: 107,586,714	F1606I	probably damaging	Het
Rasgrp4	T	C	7: 29,137,727		probably null	Het
Rlbp1	C	A	7: 79,379,913		probably null	Het
Rtp2	T	C	16: 23,927,443	D166G	probably benign	Het
Ryr3	A	C	2: 112,645,259	F4481V	probably damaging	Het
Scn2a	A	G	2: 65,701,991	D649G	possibly damaging	Het
Slc30a5	T	A	13: 100,803,442	D655V	probably damaging	Het
Slco5a1	G	A	1: 12,871,908	A838V	probably benign	Het
Srprb	A	G	9: 103,190,302	V239A	probably damaging	Het
Tceanc2	T	C	4: 107,147,640	T104A	probably benign	Het
Tcp1	T	C	17: 12,922,606		probably null	Het
Unc13b	C	T	4: 43,239,385	R1056*	probably null	Het
Wdr19	G	A	5: 65,223,504		probably benign	Het
Zadh2	A	G	18: 84,094,471	K91E	probably benign	Het
Zfhx4	T	A	3: 5,241,859	H48Q	probably benign	Het
Zfp787	T	A	7: 6,132,235	H339L	probably damaging	Het
Zfp839	G	T	12: 110,860,899	R408L	probably benign	Het

Other mutations in Kcnd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00983:Kcnd2	APN	6	21714154	missense	possibly damaging	0.90
IGL01124:Kcnd2	APN	6	21217217	missense	probably damaging	1.00
IGL01317:Kcnd2	APN	6	21727340	makesense	probably null
IGL01534:Kcnd2	APN	6	21726145	missense	probably benign
IGL02623:Kcnd2	APN	6	21726195	missense	probably benign	0.05
IGL02682:Kcnd2	APN	6	21216925	nonsense	probably null
IGL02874:Kcnd2	APN	6	21216923	missense	probably damaging	1.00
IGL02982:Kcnd2	APN	6	21217149	missense	probably damaging	1.00
IGL02983:Kcnd2	APN	6	21216555	missense	probably damaging	1.00
IGL03119:Kcnd2	APN	6	21216509	nonsense	probably null
IGL03154:Kcnd2	APN	6	21216708	missense	probably damaging	1.00
IGL03174:Kcnd2	APN	6	21216516	missense	possibly damaging	0.93
IGL03296:Kcnd2	APN	6	21714209	missense	probably damaging	1.00
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0325:Kcnd2	UTSW	6	21216683	missense	probably damaging	0.99
R0771:Kcnd2	UTSW	6	21216442	missense	probably damaging	1.00
R0836:Kcnd2	UTSW	6	21726239	splice site	probably benign
R0836:Kcnd2	UTSW	6	21727329	missense	probably damaging	1.00
R0884:Kcnd2	UTSW	6	21216541	missense	probably benign
R2116:Kcnd2	UTSW	6	21216432	missense	probably damaging	1.00
R3863:Kcnd2	UTSW	6	21217263	nonsense	probably null
R3939:Kcnd2	UTSW	6	21217096	missense	probably damaging	1.00
R4427:Kcnd2	UTSW	6	21216897	missense	probably damaging	0.99
R4561:Kcnd2	UTSW	6	21216396	missense	probably benign
R4707:Kcnd2	UTSW	6	21723212	missense	probably benign
R5523:Kcnd2	UTSW	6	21723212	missense	probably benign
R5545:Kcnd2	UTSW	6	21217019	missense	probably damaging	1.00
R5926:Kcnd2	UTSW	6	21217085	missense	probably damaging	0.99
R6900:Kcnd2	UTSW	6	21216588	missense	probably damaging	1.00
R7010:Kcnd2	UTSW	6	21216708	missense	probably damaging	1.00
R7028:Kcnd2	UTSW	6	21216178	start gained	probably benign
R7183:Kcnd2	UTSW	6	21216437	missense	probably damaging	1.00
R7387:Kcnd2	UTSW	6	21216778	missense	probably benign	0.28
R7463:Kcnd2	UTSW	6	21216498	missense	probably damaging	1.00
R8007:Kcnd2	UTSW	6	21217074	missense	probably damaging	0.99
R8305:Kcnd2	UTSW	6	21726198	nonsense	probably null
X0021:Kcnd2	UTSW	6	21217323	missense	probably damaging	0.99
Z1177:Kcnd2	UTSW	6	21216416	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCGTGTTCCTGTGAGCAGTGTCC -3'
(R):5'- GGCCAAAGAAGGCCAGTTCTTCATC -3'

Sequencing Primer
(F):5'- AGTGTCCCCCCAGTGTTTTG -3'
(R):5'- GTTCTTCATCATAAGCCGAGATGC -3'

Posted On

2014-03-14