Incidental Mutation 'R1434:Kcnd2'
ID 159376
Institutional Source Beutler Lab
Gene Symbol Kcnd2
Ensembl Gene ENSMUSG00000060882
Gene Name potassium voltage-gated channel, Shal-related family, member 2
Synonyms Kv4.2
MMRRC Submission 039489-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R1434 (G1)
Quality Score 110
Status Validated
Chromosome 6
Chromosomal Location 21215502-21729804 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21216356 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 20 (M20K)
Ref Sequence ENSEMBL: ENSMUSP00000080257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081542]
AlphaFold Q9Z0V2
Predicted Effect probably damaging
Transcript: ENSMUST00000081542
AA Change: M20K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882
AA Change: M20K

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 4.5e-16 PFAM
BTB 41 140 3.42e-14 SMART
Pfam:Ion_trans 184 417 1.4e-44 PFAM
Pfam:Ion_trans_2 330 411 5.5e-15 PFAM
low complexity region 418 437 N/A INTRINSIC
Pfam:DUF3399 445 546 5.5e-44 PFAM
low complexity region 594 608 N/A INTRINSIC
Meta Mutation Damage Score 0.3006 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G T 1: 71,348,959 (GRCm39) H851N probably benign Het
Adamtsl4 T C 3: 95,588,094 (GRCm39) Y631C probably damaging Het
Ankhd1 A G 18: 36,758,212 (GRCm39) I969V probably benign Het
Apob A G 12: 8,059,715 (GRCm39) I2699M probably damaging Het
Aqr A T 2: 113,980,890 (GRCm39) L297Q probably damaging Het
Arb2a A T 13: 77,910,041 (GRCm39) Y98F probably damaging Het
Camsap1 A G 2: 25,835,190 (GRCm39) Y301H probably damaging Het
Ccdc88c A G 12: 100,905,425 (GRCm39) probably benign Het
Cd209b T A 8: 3,973,367 (GRCm39) I106F possibly damaging Het
Cdkn1b T A 6: 134,898,060 (GRCm39) W60R probably damaging Het
Coasy A G 11: 100,975,822 (GRCm39) probably benign Het
Col2a1 T A 15: 97,877,532 (GRCm39) Q1017L probably damaging Het
Cspg4b G A 13: 113,505,026 (GRCm39) V510I possibly damaging Het
Ctnnal1 T A 4: 56,847,971 (GRCm39) N56I probably damaging Het
Cyb561d2 T A 9: 107,418,842 (GRCm39) probably benign Het
Dcst1 G T 3: 89,259,826 (GRCm39) T632N probably damaging Het
Ddx1 C T 12: 13,287,232 (GRCm39) V267I probably benign Het
Dnah10 A T 5: 124,852,050 (GRCm39) M1736L probably benign Het
Eln G A 5: 134,758,291 (GRCm39) probably benign Het
Elp1 T A 4: 56,781,193 (GRCm39) E493D probably benign Het
Enpp2 A T 15: 54,726,077 (GRCm39) D566E probably damaging Het
Ezh1 T C 11: 101,085,743 (GRCm39) K638R probably damaging Het
Fdx2 C A 9: 20,984,694 (GRCm39) G37W probably benign Het
Grin2b T C 6: 135,820,193 (GRCm39) I340V probably benign Het
Il16 T C 7: 83,304,520 (GRCm39) T671A probably benign Het
Kndc1 C T 7: 139,502,600 (GRCm39) S962F probably damaging Het
L1td1 A G 4: 98,626,054 (GRCm39) S750G possibly damaging Het
Lama2 A G 10: 27,084,366 (GRCm39) C935R probably damaging Het
Lgalsl T C 11: 20,776,418 (GRCm39) D158G possibly damaging Het
Lman1 A T 18: 66,126,144 (GRCm39) probably null Het
Lmtk2 A G 5: 144,111,407 (GRCm39) E709G probably damaging Het
Lrfn3 T C 7: 30,055,352 (GRCm39) H531R possibly damaging Het
Mark3 A G 12: 111,589,759 (GRCm39) probably benign Het
Mov10 T C 3: 104,702,490 (GRCm39) E997G probably damaging Het
Myo15a T A 11: 60,395,157 (GRCm39) W2484R probably benign Het
Myo1g G T 11: 6,459,372 (GRCm39) Q833K probably benign Het
Ncoa3 T A 2: 165,897,430 (GRCm39) D740E probably benign Het
Nol12 A G 15: 78,822,153 (GRCm39) probably benign Het
Nrxn2 T A 19: 6,493,642 (GRCm39) probably null Het
Nsfl1c A C 2: 151,342,666 (GRCm39) I79L probably benign Het
Or52b2 T C 7: 104,986,468 (GRCm39) I152V probably benign Het
Or5b108 A G 19: 13,168,662 (GRCm39) I210M probably benign Het
Or5k1 G T 16: 58,617,811 (GRCm39) H133N probably benign Het
Osbpl8 A C 10: 111,127,442 (GRCm39) E842A probably benign Het
Pdxk G T 10: 78,276,645 (GRCm39) T310K probably benign Het
Phip T G 9: 82,841,658 (GRCm39) K54Q probably damaging Het
Pklr A T 3: 89,050,342 (GRCm39) D366V probably damaging Het
Plxna2 T A 1: 194,433,848 (GRCm39) probably benign Het
Ppp4r3a A T 12: 101,009,783 (GRCm39) V618E probably damaging Het
Prdm12 A T 2: 31,530,319 (GRCm39) Q70L possibly damaging Het
Ptgr3 A G 18: 84,112,596 (GRCm39) K91E probably benign Het
Ptpn21 A T 12: 98,654,849 (GRCm39) M706K probably damaging Het
Ptprq A T 10: 107,422,575 (GRCm39) F1606I probably damaging Het
Rasgrp4 T C 7: 28,837,152 (GRCm39) probably null Het
Rlbp1 C A 7: 79,029,661 (GRCm39) probably null Het
Rtp2 T C 16: 23,746,193 (GRCm39) D166G probably benign Het
Ryr3 A C 2: 112,475,604 (GRCm39) F4481V probably damaging Het
Scn2a A G 2: 65,532,335 (GRCm39) D649G possibly damaging Het
Slc30a5 T A 13: 100,939,950 (GRCm39) D655V probably damaging Het
Slco5a1 G A 1: 12,942,132 (GRCm39) A838V probably benign Het
Spata6l G T 19: 28,905,039 (GRCm39) probably benign Het
Srprb A G 9: 103,067,501 (GRCm39) V239A probably damaging Het
Tceanc2 T C 4: 107,004,837 (GRCm39) T104A probably benign Het
Tcp1 T C 17: 13,141,493 (GRCm39) probably null Het
Unc13b C T 4: 43,239,385 (GRCm39) R1056* probably null Het
Wdr19 G A 5: 65,380,847 (GRCm39) probably benign Het
Zfhx4 T A 3: 5,306,919 (GRCm39) H48Q probably benign Het
Zfp787 T A 7: 6,135,234 (GRCm39) H339L probably damaging Het
Zfp839 G T 12: 110,827,333 (GRCm39) R408L probably benign Het
Other mutations in Kcnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Kcnd2 APN 6 21,714,153 (GRCm39) missense possibly damaging 0.90
IGL01124:Kcnd2 APN 6 21,217,216 (GRCm39) missense probably damaging 1.00
IGL01317:Kcnd2 APN 6 21,727,339 (GRCm39) makesense probably null
IGL01534:Kcnd2 APN 6 21,726,144 (GRCm39) missense probably benign
IGL02623:Kcnd2 APN 6 21,726,194 (GRCm39) missense probably benign 0.05
IGL02682:Kcnd2 APN 6 21,216,924 (GRCm39) nonsense probably null
IGL02874:Kcnd2 APN 6 21,216,922 (GRCm39) missense probably damaging 1.00
IGL02982:Kcnd2 APN 6 21,217,148 (GRCm39) missense probably damaging 1.00
IGL02983:Kcnd2 APN 6 21,216,554 (GRCm39) missense probably damaging 1.00
IGL03119:Kcnd2 APN 6 21,216,508 (GRCm39) nonsense probably null
IGL03154:Kcnd2 APN 6 21,216,707 (GRCm39) missense probably damaging 1.00
IGL03174:Kcnd2 APN 6 21,216,515 (GRCm39) missense possibly damaging 0.93
IGL03296:Kcnd2 APN 6 21,714,208 (GRCm39) missense probably damaging 1.00
R0062:Kcnd2 UTSW 6 21,727,225 (GRCm39) missense possibly damaging 0.80
R0062:Kcnd2 UTSW 6 21,727,225 (GRCm39) missense possibly damaging 0.80
R0325:Kcnd2 UTSW 6 21,216,682 (GRCm39) missense probably damaging 0.99
R0771:Kcnd2 UTSW 6 21,216,441 (GRCm39) missense probably damaging 1.00
R0836:Kcnd2 UTSW 6 21,727,328 (GRCm39) missense probably damaging 1.00
R0836:Kcnd2 UTSW 6 21,726,238 (GRCm39) splice site probably benign
R0884:Kcnd2 UTSW 6 21,216,540 (GRCm39) missense probably benign
R2116:Kcnd2 UTSW 6 21,216,431 (GRCm39) missense probably damaging 1.00
R3863:Kcnd2 UTSW 6 21,217,262 (GRCm39) nonsense probably null
R3939:Kcnd2 UTSW 6 21,217,095 (GRCm39) missense probably damaging 1.00
R4427:Kcnd2 UTSW 6 21,216,896 (GRCm39) missense probably damaging 0.99
R4561:Kcnd2 UTSW 6 21,216,395 (GRCm39) missense probably benign
R4707:Kcnd2 UTSW 6 21,723,211 (GRCm39) missense probably benign
R5523:Kcnd2 UTSW 6 21,723,211 (GRCm39) missense probably benign
R5545:Kcnd2 UTSW 6 21,217,018 (GRCm39) missense probably damaging 1.00
R5926:Kcnd2 UTSW 6 21,217,084 (GRCm39) missense probably damaging 0.99
R6900:Kcnd2 UTSW 6 21,216,587 (GRCm39) missense probably damaging 1.00
R7010:Kcnd2 UTSW 6 21,216,707 (GRCm39) missense probably damaging 1.00
R7028:Kcnd2 UTSW 6 21,216,177 (GRCm39) start gained probably benign
R7183:Kcnd2 UTSW 6 21,216,436 (GRCm39) missense probably damaging 1.00
R7387:Kcnd2 UTSW 6 21,216,777 (GRCm39) missense probably benign 0.28
R7463:Kcnd2 UTSW 6 21,216,497 (GRCm39) missense probably damaging 1.00
R8007:Kcnd2 UTSW 6 21,217,073 (GRCm39) missense probably damaging 0.99
R8305:Kcnd2 UTSW 6 21,726,197 (GRCm39) nonsense probably null
R8465:Kcnd2 UTSW 6 21,216,695 (GRCm39) missense probably damaging 1.00
R9329:Kcnd2 UTSW 6 21,725,981 (GRCm39) missense probably damaging 1.00
R9532:Kcnd2 UTSW 6 21,727,180 (GRCm39) missense probably benign 0.16
R9766:Kcnd2 UTSW 6 21,216,367 (GRCm39) missense probably benign 0.20
X0021:Kcnd2 UTSW 6 21,217,322 (GRCm39) missense probably damaging 0.99
Z1177:Kcnd2 UTSW 6 21,216,415 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGTGTTCCTGTGAGCAGTGTCC -3'
(R):5'- GGCCAAAGAAGGCCAGTTCTTCATC -3'

Sequencing Primer
(F):5'- AGTGTCCCCCCAGTGTTTTG -3'
(R):5'- GTTCTTCATCATAAGCCGAGATGC -3'
Posted On 2014-03-14