Incidental Mutation 'R1434:Grin2b'
ID159378
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Nameglutamate receptor, ionotropic, NMDA2B (epsilon 2)
SynonymsGluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
MMRRC Submission 039489-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1434 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location135713233-136173511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135843195 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 340 (I340V)
Ref Sequence ENSEMBL: ENSMUSP00000107536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
Predicted Effect probably benign
Transcript: ENSMUST00000053880
AA Change: I340V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: I340V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111905
AA Change: I340V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: I340V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik G T 19: 28,927,639 probably benign Het
Abca12 G T 1: 71,309,800 H851N probably benign Het
Adamtsl4 T C 3: 95,680,784 Y631C probably damaging Het
Ankhd1 A G 18: 36,625,159 I969V probably benign Het
Apob A G 12: 8,009,715 I2699M probably damaging Het
Aqr A T 2: 114,150,409 L297Q probably damaging Het
BC067074 G A 13: 113,368,492 V510I possibly damaging Het
Camsap1 A G 2: 25,945,178 Y301H probably damaging Het
Ccdc88c A G 12: 100,939,166 probably benign Het
Cd209b T A 8: 3,923,367 I106F possibly damaging Het
Cdkn1b T A 6: 134,921,097 W60R probably damaging Het
Coasy A G 11: 101,084,996 probably benign Het
Col2a1 T A 15: 97,979,651 Q1017L probably damaging Het
Ctnnal1 T A 4: 56,847,971 N56I probably damaging Het
Cyb561d2 T A 9: 107,541,643 probably benign Het
Dcst1 G T 3: 89,352,519 T632N probably damaging Het
Ddx1 C T 12: 13,237,231 V267I probably benign Het
Dnah10 A T 5: 124,774,986 M1736L probably benign Het
Eln G A 5: 134,729,437 probably benign Het
Enpp2 A T 15: 54,862,681 D566E probably damaging Het
Ezh1 T C 11: 101,194,917 K638R probably damaging Het
Fam172a A T 13: 77,761,922 Y98F probably damaging Het
Fdx1l C A 9: 21,073,398 G37W probably benign Het
Ikbkap T A 4: 56,781,193 E493D probably benign Het
Il16 T C 7: 83,655,312 T671A probably benign Het
Kcnd2 T A 6: 21,216,357 M20K probably damaging Het
Kndc1 C T 7: 139,922,684 S962F probably damaging Het
L1td1 A G 4: 98,737,817 S750G possibly damaging Het
Lama2 A G 10: 27,208,370 C935R probably damaging Het
Lgalsl T C 11: 20,826,418 D158G possibly damaging Het
Lman1 A T 18: 65,993,073 probably null Het
Lmtk2 A G 5: 144,174,589 E709G probably damaging Het
Lrfn3 T C 7: 30,355,927 H531R possibly damaging Het
Mark3 A G 12: 111,623,325 probably benign Het
Mov10 T C 3: 104,795,174 E997G probably damaging Het
Myo15 T A 11: 60,504,331 W2484R probably benign Het
Myo1g G T 11: 6,509,372 Q833K probably benign Het
Ncoa3 T A 2: 166,055,510 D740E probably benign Het
Nol12 A G 15: 78,937,953 probably benign Het
Nrxn2 T A 19: 6,443,612 probably null Het
Nsfl1c A C 2: 151,500,746 I79L probably benign Het
Olfr1462 A G 19: 13,191,298 I210M probably benign Het
Olfr173 G T 16: 58,797,448 H133N probably benign Het
Olfr691 T C 7: 105,337,261 I152V probably benign Het
Osbpl8 A C 10: 111,291,581 E842A probably benign Het
Pdxk G T 10: 78,440,811 T310K probably benign Het
Phip T G 9: 82,959,605 K54Q probably damaging Het
Pklr A T 3: 89,143,035 D366V probably damaging Het
Plxna2 T A 1: 194,751,540 probably benign Het
Ppp4r3a A T 12: 101,043,524 V618E probably damaging Het
Prdm12 A T 2: 31,640,307 Q70L possibly damaging Het
Ptpn21 A T 12: 98,688,590 M706K probably damaging Het
Ptprq A T 10: 107,586,714 F1606I probably damaging Het
Rasgrp4 T C 7: 29,137,727 probably null Het
Rlbp1 C A 7: 79,379,913 probably null Het
Rtp2 T C 16: 23,927,443 D166G probably benign Het
Ryr3 A C 2: 112,645,259 F4481V probably damaging Het
Scn2a A G 2: 65,701,991 D649G possibly damaging Het
Slc30a5 T A 13: 100,803,442 D655V probably damaging Het
Slco5a1 G A 1: 12,871,908 A838V probably benign Het
Srprb A G 9: 103,190,302 V239A probably damaging Het
Tceanc2 T C 4: 107,147,640 T104A probably benign Het
Tcp1 T C 17: 12,922,606 probably null Het
Unc13b C T 4: 43,239,385 R1056* probably null Het
Wdr19 G A 5: 65,223,504 probably benign Het
Zadh2 A G 18: 84,094,471 K91E probably benign Het
Zfhx4 T A 3: 5,241,859 H48Q probably benign Het
Zfp787 T A 7: 6,132,235 H339L probably damaging Het
Zfp839 G T 12: 110,860,899 R408L probably benign Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135736331 missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135733570 missense probably damaging 1.00
IGL01401:Grin2b APN 6 135736363 missense probably damaging 1.00
IGL01523:Grin2b APN 6 136044265 missense probably null 0.99
IGL01719:Grin2b APN 6 135733381 missense probably damaging 0.97
IGL01907:Grin2b APN 6 135733740 missense probably damaging 1.00
IGL01996:Grin2b APN 6 135732586 missense probably damaging 1.00
IGL02309:Grin2b APN 6 135736472 missense probably damaging 1.00
IGL02312:Grin2b APN 6 135739090 missense probably damaging 1.00
IGL02409:Grin2b APN 6 136043908 missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135923391 missense probably damaging 1.00
IGL02535:Grin2b APN 6 135779369 missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135922998 missense probably damaging 1.00
IGL02702:Grin2b APN 6 135739132 missense probably damaging 0.99
IGL03001:Grin2b APN 6 135739115 missense probably damaging 1.00
IGL03274:Grin2b APN 6 135780255 missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0164:Grin2b UTSW 6 135778648 splice site probably benign
R0194:Grin2b UTSW 6 135779305 missense probably damaging 1.00
R0594:Grin2b UTSW 6 135733929 missense probably damaging 1.00
R1928:Grin2b UTSW 6 136044046 missense probably damaging 1.00
R1942:Grin2b UTSW 6 135732732 missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136044211 missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135733245 missense probably damaging 1.00
R2020:Grin2b UTSW 6 135733896 missense probably benign 0.12
R2103:Grin2b UTSW 6 135780140 missense probably benign 0.02
R2127:Grin2b UTSW 6 135778700 missense probably benign 0.03
R2495:Grin2b UTSW 6 135733182 missense probably damaging 1.00
R2656:Grin2b UTSW 6 135733429 missense probably damaging 1.00
R2847:Grin2b UTSW 6 135740953 missense probably damaging 1.00
R2866:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R3196:Grin2b UTSW 6 135732455 small deletion probably benign
R3418:Grin2b UTSW 6 135843110 missense probably benign 0.02
R3808:Grin2b UTSW 6 135923271 missense probably damaging 0.99
R4028:Grin2b UTSW 6 135736435 missense probably damaging 1.00
R4602:Grin2b UTSW 6 135778741 missense probably damaging 1.00
R4624:Grin2b UTSW 6 135733825 missense probably damaging 0.99
R4677:Grin2b UTSW 6 135774872 missense probably benign 0.13
R4744:Grin2b UTSW 6 135778699 missense probably damaging 1.00
R5020:Grin2b UTSW 6 135733407 missense probably benign 0.01
R5051:Grin2b UTSW 6 135779395 missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135732441 missense probably benign 0.03
R5125:Grin2b UTSW 6 135923299 missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135779342 missense probably damaging 1.00
R5318:Grin2b UTSW 6 135733918 missense probably damaging 0.99
R5349:Grin2b UTSW 6 136044283 missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135732368 missense probably damaging 1.00
R5438:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5439:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5440:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5530:Grin2b UTSW 6 135733723 missense probably benign 0.00
R5603:Grin2b UTSW 6 135923397 missense probably damaging 1.00
R5657:Grin2b UTSW 6 135733087 missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135740964 missense probably benign 0.24
R5941:Grin2b UTSW 6 135736373 missense probably damaging 0.99
R6057:Grin2b UTSW 6 135733944 missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135923458 missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135772399 missense probably damaging 1.00
R6309:Grin2b UTSW 6 135733027 missense probably benign 0.00
R6316:Grin2b UTSW 6 135780279 missense probably benign 0.00
R6419:Grin2b UTSW 6 135740967 missense probably damaging 1.00
R6551:Grin2b UTSW 6 135733344 missense probably damaging 1.00
R6612:Grin2b UTSW 6 135740998 missense probably damaging 1.00
R6616:Grin2b UTSW 6 135732551 missense probably benign
R6647:Grin2b UTSW 6 135733110 missense probably damaging 1.00
R6806:Grin2b UTSW 6 135774828 missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135780200 missense probably benign
R7033:Grin2b UTSW 6 135923038 missense probably damaging 1.00
R7058:Grin2b UTSW 6 135780306 missense probably damaging 0.97
R7144:Grin2b UTSW 6 135733476 missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135732948 missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135780251 missense probably damaging 0.97
R7453:Grin2b UTSW 6 135740949 missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135772396 missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135779303 missense probably damaging 0.99
R7615:Grin2b UTSW 6 135923364 missense probably damaging 1.00
R7632:Grin2b UTSW 6 135732555 missense probably benign 0.02
R7779:Grin2b UTSW 6 135778794 nonsense probably null
R8058:Grin2b UTSW 6 135733227 missense probably damaging 1.00
R8084:Grin2b UTSW 6 135733488 missense probably benign 0.03
R8145:Grin2b UTSW 6 135732499 missense probably benign 0.01
R8308:Grin2b UTSW 6 135923076 missense probably damaging 0.99
R8357:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8379:Grin2b UTSW 6 135922969 missense probably damaging 1.00
RF001:Grin2b UTSW 6 136044240 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAACACCTGCCTGTCTACTTAGCTC -3'
(R):5'- GGCAGAAAGTTGTCTTGATACATAGCCA -3'

Sequencing Primer
(F):5'- CTCAAGGATTGCCAAAGTCATGTC -3'
(R):5'- gctgccctcagagaagac -3'
Posted On2014-03-14