Incidental Mutation 'R1434:Rasgrp4'
ID 159380
Institutional Source Beutler Lab
Gene Symbol Rasgrp4
Ensembl Gene ENSMUSG00000030589
Gene Name RAS guanyl releasing protein 4
Synonyms
MMRRC Submission 039489-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1434 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 29134851-29153961 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 29137727 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032811] [ENSMUST00000032811] [ENSMUST00000094617] [ENSMUST00000094617] [ENSMUST00000159351] [ENSMUST00000159975] [ENSMUST00000159975] [ENSMUST00000160194] [ENSMUST00000160194] [ENSMUST00000161522] [ENSMUST00000161522] [ENSMUST00000203070] [ENSMUST00000203070] [ENSMUST00000203380] [ENSMUST00000203380] [ENSMUST00000204194] [ENSMUST00000204194] [ENSMUST00000204845] [ENSMUST00000204845] [ENSMUST00000205027] [ENSMUST00000205027]
AlphaFold Q8BTM9
Predicted Effect probably null
Transcript: ENSMUST00000032811
SMART Domains Protein: ENSMUSP00000032811
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 590 4.12e-12 SMART
low complexity region 600 609 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000032811
SMART Domains Protein: ENSMUSP00000032811
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 590 4.12e-12 SMART
low complexity region 600 609 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000094617
SMART Domains Protein: ENSMUSP00000092200
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 163 2e-29 BLAST
low complexity region 164 189 N/A INTRINSIC
RasGEF 198 434 2.92e-70 SMART
C1 542 596 1.81e-8 SMART
low complexity region 606 615 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000094617
SMART Domains Protein: ENSMUSP00000092200
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 163 2e-29 BLAST
low complexity region 164 189 N/A INTRINSIC
RasGEF 198 434 2.92e-70 SMART
C1 542 596 1.81e-8 SMART
low complexity region 606 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159351
SMART Domains Protein: ENSMUSP00000124183
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 7e-31 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
Blast:RasGEF 449 553 7e-25 BLAST
SCOP:d1ptq__ 541 573 1e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159898
Predicted Effect probably null
Transcript: ENSMUST00000159975
SMART Domains Protein: ENSMUSP00000125137
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 595 1.81e-8 SMART
low complexity region 605 614 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159975
SMART Domains Protein: ENSMUSP00000125137
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 595 1.81e-8 SMART
low complexity region 605 614 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160194
SMART Domains Protein: ENSMUSP00000124908
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 8e-32 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 423 6.73e-61 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160194
SMART Domains Protein: ENSMUSP00000124908
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 8e-32 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 423 6.73e-61 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161522
SMART Domains Protein: ENSMUSP00000123718
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 165 7e-32 BLAST
RasGEF 183 419 2.92e-70 SMART
C1 527 576 4.12e-12 SMART
low complexity region 586 595 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161522
SMART Domains Protein: ENSMUSP00000123718
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 165 7e-32 BLAST
RasGEF 183 419 2.92e-70 SMART
C1 527 576 4.12e-12 SMART
low complexity region 586 595 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162946
Predicted Effect probably null
Transcript: ENSMUST00000203070
SMART Domains Protein: ENSMUSP00000145352
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 504 1.8e-20 SMART
C1 449 498 2.1e-14 SMART
low complexity region 508 517 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203070
SMART Domains Protein: ENSMUSP00000145352
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 504 1.8e-20 SMART
C1 449 498 2.1e-14 SMART
low complexity region 508 517 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203380
SMART Domains Protein: ENSMUSP00000144753
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 364 3e-25 SMART
C1 472 521 2.1e-14 SMART
low complexity region 531 540 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203380
SMART Domains Protein: ENSMUSP00000144753
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 364 3e-25 SMART
C1 472 521 2.1e-14 SMART
low complexity region 531 540 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000204194
SMART Domains Protein: ENSMUSP00000145259
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 85 336 1e-7 SMART
C1 444 493 2.1e-14 SMART
low complexity region 503 512 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000204194
SMART Domains Protein: ENSMUSP00000145259
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 85 336 1e-7 SMART
C1 444 493 2.1e-14 SMART
low complexity region 503 512 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000204845
SMART Domains Protein: ENSMUSP00000144774
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 399 8.7e-49 SMART
C1 507 556 2.1e-14 SMART
low complexity region 566 575 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000204845
SMART Domains Protein: ENSMUSP00000144774
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 399 8.7e-49 SMART
C1 507 556 2.1e-14 SMART
low complexity region 566 575 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000205027
SMART Domains Protein: ENSMUSP00000145186
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
C1 352 401 2.1e-14 SMART
low complexity region 411 420 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000205027
SMART Domains Protein: ENSMUSP00000145186
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
C1 352 401 2.1e-14 SMART
low complexity region 411 420 N/A INTRINSIC
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ras guanyl nucleotide-releasing protein (RasGRP) family of Ras guanine nucleotide exchange factors. It contains a Ras exchange motif, a diacylglycerol-binding domain, and two calcium-binding EF hands. This protein was shown to activate H-Ras in a cation-dependent manner in vitro. Expression of this protein in myeloid cell lines was found to be correlated with elevated level of activated RAS protein, and the RAS activation can be greatly enhanced by phorbol ester treatment, which suggested a role of this protein in diacylglycerol regulated cell signaling pathways. Studies of a mast cell leukemia cell line expressing substantial amounts of abnormal transcripts of this gene indicated that this gene may play an important role in the final stages of mast cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired neutrophil reactive oxygen species production and chemotaxis in vitro. Mice homozygous for another knock-out allele exhibit decreased susceptibility to induced colitis and arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik G T 19: 28,927,639 probably benign Het
Abca12 G T 1: 71,309,800 H851N probably benign Het
Adamtsl4 T C 3: 95,680,784 Y631C probably damaging Het
Ankhd1 A G 18: 36,625,159 I969V probably benign Het
Apob A G 12: 8,009,715 I2699M probably damaging Het
Aqr A T 2: 114,150,409 L297Q probably damaging Het
BC067074 G A 13: 113,368,492 V510I possibly damaging Het
Camsap1 A G 2: 25,945,178 Y301H probably damaging Het
Ccdc88c A G 12: 100,939,166 probably benign Het
Cd209b T A 8: 3,923,367 I106F possibly damaging Het
Cdkn1b T A 6: 134,921,097 W60R probably damaging Het
Coasy A G 11: 101,084,996 probably benign Het
Col2a1 T A 15: 97,979,651 Q1017L probably damaging Het
Ctnnal1 T A 4: 56,847,971 N56I probably damaging Het
Cyb561d2 T A 9: 107,541,643 probably benign Het
Dcst1 G T 3: 89,352,519 T632N probably damaging Het
Ddx1 C T 12: 13,237,231 V267I probably benign Het
Dnah10 A T 5: 124,774,986 M1736L probably benign Het
Eln G A 5: 134,729,437 probably benign Het
Enpp2 A T 15: 54,862,681 D566E probably damaging Het
Ezh1 T C 11: 101,194,917 K638R probably damaging Het
Fam172a A T 13: 77,761,922 Y98F probably damaging Het
Fdx1l C A 9: 21,073,398 G37W probably benign Het
Grin2b T C 6: 135,843,195 I340V probably benign Het
Ikbkap T A 4: 56,781,193 E493D probably benign Het
Il16 T C 7: 83,655,312 T671A probably benign Het
Kcnd2 T A 6: 21,216,357 M20K probably damaging Het
Kndc1 C T 7: 139,922,684 S962F probably damaging Het
L1td1 A G 4: 98,737,817 S750G possibly damaging Het
Lama2 A G 10: 27,208,370 C935R probably damaging Het
Lgalsl T C 11: 20,826,418 D158G possibly damaging Het
Lman1 A T 18: 65,993,073 probably null Het
Lmtk2 A G 5: 144,174,589 E709G probably damaging Het
Lrfn3 T C 7: 30,355,927 H531R possibly damaging Het
Mark3 A G 12: 111,623,325 probably benign Het
Mov10 T C 3: 104,795,174 E997G probably damaging Het
Myo15 T A 11: 60,504,331 W2484R probably benign Het
Myo1g G T 11: 6,509,372 Q833K probably benign Het
Ncoa3 T A 2: 166,055,510 D740E probably benign Het
Nol12 A G 15: 78,937,953 probably benign Het
Nrxn2 T A 19: 6,443,612 probably null Het
Nsfl1c A C 2: 151,500,746 I79L probably benign Het
Olfr1462 A G 19: 13,191,298 I210M probably benign Het
Olfr173 G T 16: 58,797,448 H133N probably benign Het
Olfr691 T C 7: 105,337,261 I152V probably benign Het
Osbpl8 A C 10: 111,291,581 E842A probably benign Het
Pdxk G T 10: 78,440,811 T310K probably benign Het
Phip T G 9: 82,959,605 K54Q probably damaging Het
Pklr A T 3: 89,143,035 D366V probably damaging Het
Plxna2 T A 1: 194,751,540 probably benign Het
Ppp4r3a A T 12: 101,043,524 V618E probably damaging Het
Prdm12 A T 2: 31,640,307 Q70L possibly damaging Het
Ptpn21 A T 12: 98,688,590 M706K probably damaging Het
Ptprq A T 10: 107,586,714 F1606I probably damaging Het
Rlbp1 C A 7: 79,379,913 probably null Het
Rtp2 T C 16: 23,927,443 D166G probably benign Het
Ryr3 A C 2: 112,645,259 F4481V probably damaging Het
Scn2a A G 2: 65,701,991 D649G possibly damaging Het
Slc30a5 T A 13: 100,803,442 D655V probably damaging Het
Slco5a1 G A 1: 12,871,908 A838V probably benign Het
Srprb A G 9: 103,190,302 V239A probably damaging Het
Tceanc2 T C 4: 107,147,640 T104A probably benign Het
Tcp1 T C 17: 12,922,606 probably null Het
Unc13b C T 4: 43,239,385 R1056* probably null Het
Wdr19 G A 5: 65,223,504 probably benign Het
Zadh2 A G 18: 84,094,471 K91E probably benign Het
Zfhx4 T A 3: 5,241,859 H48Q probably benign Het
Zfp787 T A 7: 6,132,235 H339L probably damaging Het
Zfp839 G T 12: 110,860,899 R408L probably benign Het
Other mutations in Rasgrp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Rasgrp4 APN 7 29148541 splice site probably benign
IGL01145:Rasgrp4 APN 7 29151473 missense possibly damaging 0.83
IGL01806:Rasgrp4 APN 7 29139050 missense possibly damaging 0.83
IGL02023:Rasgrp4 APN 7 29138910 missense probably damaging 1.00
IGL02499:Rasgrp4 APN 7 29151503 utr 3 prime probably benign
IGL02989:Rasgrp4 APN 7 29148406 missense probably damaging 1.00
IGL03281:Rasgrp4 APN 7 29146025 missense possibly damaging 0.69
R0092:Rasgrp4 UTSW 7 29145132 missense possibly damaging 0.74
R0390:Rasgrp4 UTSW 7 29145860 missense probably damaging 1.00
R0614:Rasgrp4 UTSW 7 29145851 missense probably damaging 1.00
R0628:Rasgrp4 UTSW 7 29140210 intron probably benign
R1420:Rasgrp4 UTSW 7 29140345 missense probably damaging 0.98
R1664:Rasgrp4 UTSW 7 29140263 missense probably benign 0.00
R1911:Rasgrp4 UTSW 7 29138877 missense probably damaging 1.00
R2164:Rasgrp4 UTSW 7 29139045 missense probably damaging 1.00
R4277:Rasgrp4 UTSW 7 29152594 unclassified probably benign
R5024:Rasgrp4 UTSW 7 29148407 missense probably damaging 1.00
R5423:Rasgrp4 UTSW 7 29145136 missense probably damaging 1.00
R5813:Rasgrp4 UTSW 7 29145214 missense probably damaging 1.00
R5823:Rasgrp4 UTSW 7 29137717 missense probably benign 0.00
R6268:Rasgrp4 UTSW 7 29143068 missense probably damaging 1.00
R6285:Rasgrp4 UTSW 7 29148383 missense probably damaging 1.00
R7062:Rasgrp4 UTSW 7 29150194 missense possibly damaging 0.92
R7269:Rasgrp4 UTSW 7 29148430 missense probably damaging 1.00
R7471:Rasgrp4 UTSW 7 29145980 missense probably damaging 1.00
R7535:Rasgrp4 UTSW 7 29139059 missense probably benign
R7792:Rasgrp4 UTSW 7 29143102 missense probably damaging 1.00
R7854:Rasgrp4 UTSW 7 29150610 missense unknown
R7855:Rasgrp4 UTSW 7 29150610 missense unknown
R8052:Rasgrp4 UTSW 7 29149937 missense probably damaging 1.00
R8144:Rasgrp4 UTSW 7 29149117 missense probably damaging 1.00
R8253:Rasgrp4 UTSW 7 29138862 missense possibly damaging 0.63
R8256:Rasgrp4 UTSW 7 29143075 missense probably damaging 1.00
R8671:Rasgrp4 UTSW 7 29143027 missense probably damaging 0.99
R8675:Rasgrp4 UTSW 7 29143027 missense probably damaging 0.99
R8872:Rasgrp4 UTSW 7 29139096 missense possibly damaging 0.86
R9647:Rasgrp4 UTSW 7 29140492 missense probably damaging 0.99
R9681:Rasgrp4 UTSW 7 29150262 missense probably benign
Z1088:Rasgrp4 UTSW 7 29150536 intron probably benign
Z1186:Rasgrp4 UTSW 7 29137587 missense probably benign
Z1186:Rasgrp4 UTSW 7 29138816 missense probably benign 0.01
Z1186:Rasgrp4 UTSW 7 29145877 missense probably benign 0.01
Z1186:Rasgrp4 UTSW 7 29148560 missense probably benign 0.01
Z1186:Rasgrp4 UTSW 7 29148635 missense probably damaging 1.00
Z1186:Rasgrp4 UTSW 7 29150592 intron probably benign
Z1186:Rasgrp4 UTSW 7 29150596 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGATGTGCAAGAACTTTGGTCCGT -3'
(R):5'- AAGTCTGGAACTTTATCCTCCTGCCT -3'

Sequencing Primer
(F):5'- GGAAGTCTCATCAGGAATGCTC -3'
(R):5'- TGCCTCAGCCTTCAAAGGTAAG -3'
Posted On 2014-03-14