Mutagenetix > Incidental Mutations

Incidental Mutation 'R1434:Ptpn21'

159401

Institutional Source

Beutler Lab

Gene Symbol

Ptpn21

Ensembl Gene

ENSMUSG00000021009

Gene Name

protein tyrosine phosphatase, non-receptor type 21

Synonyms

PTPD1, PTPRL10

MMRRC Submission

039489-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.169) question?

Stock #

R1434 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98676741-98737405 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 98688590 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 706 (M706K)

Ref Sequence

ENSEMBL: ENSMUSP00000152639 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535] [ENSMUST00000221932]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085116
AA Change: M706K

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009
AA Change: M706K

Domain	Start	End	E-Value	Type
B41	19	222	5.04e-69	SMART
FERM_C	226	312	4.66e-26	SMART
low complexity region	332	343	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
PTPc	897	1171	7.31e-111	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170188
AA Change: M706K

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009
AA Change: M706K

Domain	Start	End	E-Value	Type
B41	19	222	5.04e-69	SMART
FERM_C	226	312	4.66e-26	SMART
low complexity region	332	343	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
PTPc	897	1171	7.31e-111	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000221148

Predicted Effect

probably benign
Transcript: ENSMUST00000221535

Predicted Effect

probably damaging
Transcript: ENSMUST00000221932
AA Change: M706K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223321

Meta Mutation Damage Score

0.2047

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.4%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4430402I18Rik	G	T	19: 28,927,639		probably benign	Het
Abca12	G	T	1: 71,309,800	H851N	probably benign	Het
Adamtsl4	T	C	3: 95,680,784	Y631C	probably damaging	Het
Ankhd1	A	G	18: 36,625,159	I969V	probably benign	Het
Apob	A	G	12: 8,009,715	I2699M	probably damaging	Het
Aqr	A	T	2: 114,150,409	L297Q	probably damaging	Het
BC067074	G	A	13: 113,368,492	V510I	possibly damaging	Het
Camsap1	A	G	2: 25,945,178	Y301H	probably damaging	Het
Ccdc88c	A	G	12: 100,939,166		probably benign	Het
Cd209b	T	A	8: 3,923,367	I106F	possibly damaging	Het
Cdkn1b	T	A	6: 134,921,097	W60R	probably damaging	Het
Coasy	A	G	11: 101,084,996		probably benign	Het
Col2a1	T	A	15: 97,979,651	Q1017L	probably damaging	Het
Ctnnal1	T	A	4: 56,847,971	N56I	probably damaging	Het
Cyb561d2	T	A	9: 107,541,643		probably benign	Het
Dcst1	G	T	3: 89,352,519	T632N	probably damaging	Het
Ddx1	C	T	12: 13,237,231	V267I	probably benign	Het
Dnah10	A	T	5: 124,774,986	M1736L	probably benign	Het
Eln	G	A	5: 134,729,437		probably benign	Het
Enpp2	A	T	15: 54,862,681	D566E	probably damaging	Het
Ezh1	T	C	11: 101,194,917	K638R	probably damaging	Het
Fam172a	A	T	13: 77,761,922	Y98F	probably damaging	Het
Fdx1l	C	A	9: 21,073,398	G37W	probably benign	Het
Grin2b	T	C	6: 135,843,195	I340V	probably benign	Het
Ikbkap	T	A	4: 56,781,193	E493D	probably benign	Het
Il16	T	C	7: 83,655,312	T671A	probably benign	Het
Kcnd2	T	A	6: 21,216,357	M20K	probably damaging	Het
Kndc1	C	T	7: 139,922,684	S962F	probably damaging	Het
L1td1	A	G	4: 98,737,817	S750G	possibly damaging	Het
Lama2	A	G	10: 27,208,370	C935R	probably damaging	Het
Lgalsl	T	C	11: 20,826,418	D158G	possibly damaging	Het
Lman1	A	T	18: 65,993,073		probably null	Het
Lmtk2	A	G	5: 144,174,589	E709G	probably damaging	Het
Lrfn3	T	C	7: 30,355,927	H531R	possibly damaging	Het
Mark3	A	G	12: 111,623,325		probably benign	Het
Mov10	T	C	3: 104,795,174	E997G	probably damaging	Het
Myo15	T	A	11: 60,504,331	W2484R	probably benign	Het
Myo1g	G	T	11: 6,509,372	Q833K	probably benign	Het
Ncoa3	T	A	2: 166,055,510	D740E	probably benign	Het
Nol12	A	G	15: 78,937,953		probably benign	Het
Nrxn2	T	A	19: 6,443,612		probably null	Het
Nsfl1c	A	C	2: 151,500,746	I79L	probably benign	Het
Olfr1462	A	G	19: 13,191,298	I210M	probably benign	Het
Olfr173	G	T	16: 58,797,448	H133N	probably benign	Het
Olfr691	T	C	7: 105,337,261	I152V	probably benign	Het
Osbpl8	A	C	10: 111,291,581	E842A	probably benign	Het
Pdxk	G	T	10: 78,440,811	T310K	probably benign	Het
Phip	T	G	9: 82,959,605	K54Q	probably damaging	Het
Pklr	A	T	3: 89,143,035	D366V	probably damaging	Het
Plxna2	T	A	1: 194,751,540		probably benign	Het
Ppp4r3a	A	T	12: 101,043,524	V618E	probably damaging	Het
Prdm12	A	T	2: 31,640,307	Q70L	possibly damaging	Het
Ptprq	A	T	10: 107,586,714	F1606I	probably damaging	Het
Rasgrp4	T	C	7: 29,137,727		probably null	Het
Rlbp1	C	A	7: 79,379,913		probably null	Het
Rtp2	T	C	16: 23,927,443	D166G	probably benign	Het
Ryr3	A	C	2: 112,645,259	F4481V	probably damaging	Het
Scn2a	A	G	2: 65,701,991	D649G	possibly damaging	Het
Slc30a5	T	A	13: 100,803,442	D655V	probably damaging	Het
Slco5a1	G	A	1: 12,871,908	A838V	probably benign	Het
Srprb	A	G	9: 103,190,302	V239A	probably damaging	Het
Tceanc2	T	C	4: 107,147,640	T104A	probably benign	Het
Tcp1	T	C	17: 12,922,606		probably null	Het
Unc13b	C	T	4: 43,239,385	R1056*	probably null	Het
Wdr19	G	A	5: 65,223,504		probably benign	Het
Zadh2	A	G	18: 84,094,471	K91E	probably benign	Het
Zfhx4	T	A	3: 5,241,859	H48Q	probably benign	Het
Zfp787	T	A	7: 6,132,235	H339L	probably damaging	Het
Zfp839	G	T	12: 110,860,899	R408L	probably benign	Het

Other mutations in Ptpn21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Ptpn21	APN	12	98680468	missense	probably damaging	1.00
IGL00576:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00577:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00580:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00583:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00773:Ptpn21	APN	12	98688313	missense	probably benign	0.00
IGL00780:Ptpn21	APN	12	98680371	missense	probably damaging	1.00
IGL01516:Ptpn21	APN	12	98715189	missense	probably damaging	1.00
IGL01616:Ptpn21	APN	12	98680013	missense	probably damaging	1.00
IGL01939:Ptpn21	APN	12	98689161	missense	probably damaging	0.96
IGL02237:Ptpn21	APN	12	98705092	critical splice donor site	probably null
IGL02512:Ptpn21	APN	12	98679392	missense	probably benign	0.00
IGL02852:Ptpn21	APN	12	98715195	critical splice acceptor site	probably null
IGL02894:Ptpn21	APN	12	98689632	splice site	probably benign
IGL03024:Ptpn21	APN	12	98680056	missense	probably benign
IGL03220:Ptpn21	APN	12	98678623	missense	probably damaging	1.00
R0144:Ptpn21	UTSW	12	98688609	missense	probably benign	0.01
R0472:Ptpn21	UTSW	12	98704240	splice site	probably benign
R0675:Ptpn21	UTSW	12	98688216	missense	probably benign	0.16
R0771:Ptpn21	UTSW	12	98689080	missense	probably damaging	1.00
R1470:Ptpn21	UTSW	12	98688476	missense	probably benign
R1470:Ptpn21	UTSW	12	98688476	missense	probably benign
R1837:Ptpn21	UTSW	12	98733626	missense	probably damaging	0.99
R1897:Ptpn21	UTSW	12	98680405	splice site	probably null
R2048:Ptpn21	UTSW	12	98689526	missense	possibly damaging	0.94
R2376:Ptpn21	UTSW	12	98688314	missense	possibly damaging	0.62
R3709:Ptpn21	UTSW	12	98688541	missense	probably benign
R4197:Ptpn21	UTSW	12	98680138	missense	probably damaging	1.00
R4283:Ptpn21	UTSW	12	98733475	missense	probably damaging	0.99
R4368:Ptpn21	UTSW	12	98678593	missense	probably damaging	1.00
R4397:Ptpn21	UTSW	12	98688248	missense	probably damaging	1.00
R4397:Ptpn21	UTSW	12	98715060	missense	probably damaging	0.98
R4703:Ptpn21	UTSW	12	98679392	missense	probably benign	0.00
R4737:Ptpn21	UTSW	12	98708844	missense	probably benign	0.03
R4829:Ptpn21	UTSW	12	98689296	missense	probably damaging	1.00
R4926:Ptpn21	UTSW	12	98715195	critical splice acceptor site	probably null
R4974:Ptpn21	UTSW	12	98680103	missense	probably damaging	1.00
R5022:Ptpn21	UTSW	12	98679407	missense	probably damaging	1.00
R5057:Ptpn21	UTSW	12	98679407	missense	probably damaging	1.00
R5395:Ptpn21	UTSW	12	98715117	missense	probably damaging	1.00
R5608:Ptpn21	UTSW	12	98688777	missense	probably benign	0.00
R5741:Ptpn21	UTSW	12	98679289	missense	probably damaging	1.00
R5785:Ptpn21	UTSW	12	98682550	missense	probably damaging	0.99
R5959:Ptpn21	UTSW	12	98708889	splice site	probably null
R5968:Ptpn21	UTSW	12	98710890	missense	probably damaging	1.00
R5984:Ptpn21	UTSW	12	98689076	missense	probably damaging	1.00
R6005:Ptpn21	UTSW	12	98678552	makesense	probably null
R6181:Ptpn21	UTSW	12	98699999	missense	probably damaging	0.99
R6226:Ptpn21	UTSW	12	98680116	missense	probably benign	0.24
R6226:Ptpn21	UTSW	12	98715172	missense	probably damaging	1.00
R6317:Ptpn21	UTSW	12	98689262	missense	probably damaging	1.00
R6370:Ptpn21	UTSW	12	98689034	missense	possibly damaging	0.86
R6485:Ptpn21	UTSW	12	98698872	nonsense	probably null
R6894:Ptpn21	UTSW	12	98715181	missense	probably damaging	1.00
R7122:Ptpn21	UTSW	12	98688912	missense	probably damaging	0.99
R7232:Ptpn21	UTSW	12	98688737	missense	probably benign	0.17
R7289:Ptpn21	UTSW	12	98704191	missense	probably benign	0.35
R7327:Ptpn21	UTSW	12	98680101	missense	probably damaging	1.00
R7474:Ptpn21	UTSW	12	98737363	critical splice donor site	probably null
R7748:Ptpn21	UTSW	12	98688772	missense	probably benign	0.01
R7816:Ptpn21	UTSW	12	98682532	missense	probably damaging	1.00
R7867:Ptpn21	UTSW	12	98705176	missense	probably damaging	1.00
R7878:Ptpn21	UTSW	12	98715128	missense	probably damaging	1.00
R7911:Ptpn21	UTSW	12	98688842	missense	probably damaging	0.99
R8100:Ptpn21	UTSW	12	98682622	missense	possibly damaging	0.61
R8199:Ptpn21	UTSW	12	98678582	missense	possibly damaging	0.92
R8272:Ptpn21	UTSW	12	98688530	missense	probably benign
Z1177:Ptpn21	UTSW	12	98688458	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TTTCCCAGAGAGGAGGTCTGACAC -3'
(R):5'- AGGGCTCACACATGGATTCGAAGG -3'

Sequencing Primer
(F):5'- ACTGGCCTTTTCTTGACAGAG -3'
(R):5'- GGCCTGAGGCTCAAGGAG -3'

Posted On

2014-03-14