Incidental Mutation 'R1435:Phactr4'
ID159433
Institutional Source Beutler Lab
Gene Symbol Phactr4
Ensembl Gene ENSMUSG00000066043
Gene Namephosphatase and actin regulator 4
Synonyms3110001B12Rik, C330013F19Rik
MMRRC Submission 039490-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1435 (G1)
Quality Score148
Status Not validated
Chromosome4
Chromosomal Location132355923-132422489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132377248 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 256 (T256I)
Ref Sequence ENSEMBL: ENSMUSP00000081270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084170] [ENSMUST00000084249] [ENSMUST00000102568] [ENSMUST00000136711] [ENSMUST00000152271]
Predicted Effect probably benign
Transcript: ENSMUST00000084170
AA Change: T219I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081185
Gene: ENSMUSG00000066043
AA Change: T219I

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 88 103 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
low complexity region 157 182 N/A INTRINSIC
low complexity region 194 233 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 471 481 N/A INTRINSIC
low complexity region 488 497 N/A INTRINSIC
Blast:RPEL 511 535 8e-7 BLAST
RPEL 548 573 2.53e-8 SMART
RPEL 586 611 2.17e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084249
AA Change: T256I

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000081270
Gene: ENSMUSG00000066043
AA Change: T256I

DomainStartEndE-ValueType
low complexity region 52 69 N/A INTRINSIC
RPEL 73 98 1.35e-3 SMART
low complexity region 125 140 N/A INTRINSIC
low complexity region 172 186 N/A INTRINSIC
low complexity region 194 219 N/A INTRINSIC
low complexity region 231 270 N/A INTRINSIC
low complexity region 291 301 N/A INTRINSIC
low complexity region 335 359 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
low complexity region 525 534 N/A INTRINSIC
Blast:RPEL 548 572 9e-7 BLAST
RPEL 585 610 2.53e-8 SMART
RPEL 623 648 2.17e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102568
AA Change: T246I

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099628
Gene: ENSMUSG00000066043
AA Change: T246I

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
RPEL 63 88 1.35e-3 SMART
low complexity region 115 130 N/A INTRINSIC
low complexity region 162 176 N/A INTRINSIC
low complexity region 184 209 N/A INTRINSIC
low complexity region 221 260 N/A INTRINSIC
low complexity region 281 291 N/A INTRINSIC
low complexity region 325 349 N/A INTRINSIC
low complexity region 498 508 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
Blast:RPEL 538 562 9e-7 BLAST
RPEL 575 600 2.53e-8 SMART
RPEL 613 638 2.17e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136711
SMART Domains Protein: ENSMUSP00000122194
Gene: ENSMUSG00000066043

DomainStartEndE-ValueType
low complexity region 52 69 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152271
AA Change: T219I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000119767
Gene: ENSMUSG00000066043
AA Change: T219I

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 88 103 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
low complexity region 157 182 N/A INTRINSIC
low complexity region 194 233 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.0%
  • 20x: 81.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatase and actin regulator (PHACTR) family. Other PHACTR family members have been shown to inhibit protein phosphatase 1 (PP1) activity, and the homolog of this gene in the mouse has been shown to interact with actin and PP1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality, exencephaly, neural tube defects, coloboma, and altered cell cycles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,326,082 T209A probably benign Het
Acadvl T G 11: 70,014,816 T62P probably benign Het
AF067061 T A 13: 120,263,988 W63R probably damaging Het
Amz1 A T 5: 140,748,166 N166Y probably damaging Het
Anxa6 T C 11: 54,991,410 Q518R probably benign Het
Aox3 G A 1: 58,163,446 probably null Het
Arid1a C T 4: 133,680,698 R2166Q unknown Het
Armc4 T A 18: 7,222,646 H541L probably benign Het
Asb4 T G 6: 5,398,410 I125S probably benign Het
Aspscr1 T C 11: 120,689,222 S196P probably benign Het
Atxn3 A G 12: 101,942,201 F131L probably benign Het
B3gnt5 T A 16: 19,769,174 Y48N probably damaging Het
Bglap3 A G 3: 88,369,146 M35T possibly damaging Het
Cabp1 A T 5: 115,173,208 D79E probably damaging Het
Chd2 C T 7: 73,453,136 R1367Q probably damaging Het
Clec5a T A 6: 40,584,424 Q29L probably damaging Het
Cmtr2 T C 8: 110,221,079 L7P probably benign Het
Cnbd1 T C 4: 18,907,026 I183V probably benign Het
Col7a1 G A 9: 108,963,273 G1297D unknown Het
Csnk1g3 G A 18: 53,906,674 probably null Het
Cyp4a32 A T 4: 115,606,666 N134I probably damaging Het
Cyp4f16 CTATG CTATGTATG 17: 32,550,734 probably null Het
Dst G A 1: 34,113,945 V56M probably damaging Het
Engase A T 11: 118,484,901 T32S probably damaging Het
Fam117b T C 1: 59,969,063 I352T possibly damaging Het
Golga4 C A 9: 118,535,440 D290E probably benign Het
Gtf2a1l C A 17: 88,694,315 H153N probably damaging Het
Hivep1 C A 13: 42,158,043 T1253N probably damaging Het
Hps1 T C 19: 42,762,275 S398G probably benign Het
Il1r2 T A 1: 40,105,299 F49I probably damaging Het
Iqsec1 A G 6: 90,672,024 S808P probably damaging Het
Lrrk1 A G 7: 66,273,028 L289P probably damaging Het
Magi2 T A 5: 20,358,945 D358E probably damaging Het
Man2b2 A G 5: 36,813,067 W832R probably damaging Het
Mfsd4a G T 1: 132,067,756 T46K probably damaging Het
N4bp3 G A 11: 51,644,340 R341W probably damaging Het
Olfr284 A T 15: 98,340,328 H220Q possibly damaging Het
Olfr568 T C 7: 102,877,767 S216P probably damaging Het
Otof A G 5: 30,378,695 L1353S probably benign Het
Pcsk5 A T 19: 17,563,882 C844* probably null Het
Pdk2 T C 11: 95,031,895 Y153C probably damaging Het
Pes1 T C 11: 3,976,075 V292A probably benign Het
Pex14 T C 4: 148,963,527 T198A probably benign Het
Pnpla2 G A 7: 141,457,411 R109H probably benign Het
Polh G A 17: 46,194,255 T145I probably damaging Het
Polr3d A T 14: 70,440,039 V299E probably benign Het
Polr3e C T 7: 120,940,788 T586M probably benign Het
Rbm20 T A 19: 53,814,157 F365L probably benign Het
Rnf213 G T 11: 119,436,005 C1606F probably damaging Het
Sipa1l2 A G 8: 125,468,725 V758A probably damaging Het
Slc22a16 T A 10: 40,587,607 M451K probably damaging Het
Slc28a1 T C 7: 81,153,517 S359P probably damaging Het
Slc45a1 G T 4: 150,644,048 F99L probably damaging Het
Sp3 A T 2: 72,938,156 N754K possibly damaging Het
Taf4b A T 18: 14,807,409 Q315L probably damaging Het
Tmem2 A T 19: 21,844,706 Q1155L probably benign Het
Tmprss15 A T 16: 79,021,454 N544K probably benign Het
Tnfsf13b A G 8: 10,035,358 I283V probably benign Het
Tnfsf14 T A 17: 57,190,605 E209V possibly damaging Het
Uckl1 T G 2: 181,573,133 S283R probably benign Het
Ush1g T C 11: 115,318,468 D300G probably damaging Het
Virma C T 4: 11,528,621 A1286V probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r59 A T 7: 42,046,205 M261K possibly damaging Het
Vwf A T 6: 125,642,249 K1297* probably null Het
Zdbf2 G A 1: 63,303,040 E193K possibly damaging Het
Zfp759 T G 13: 67,138,766 I127S possibly damaging Het
Other mutations in Phactr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Phactr4 APN 4 132370992 missense possibly damaging 0.94
IGL01106:Phactr4 APN 4 132370805 missense probably benign 0.09
IGL01962:Phactr4 APN 4 132363775 missense probably damaging 0.99
IGL02382:Phactr4 APN 4 132370841 missense probably damaging 1.00
IGL02466:Phactr4 APN 4 132377172 splice site probably benign
IGL02891:Phactr4 APN 4 132387023 missense probably damaging 1.00
P0027:Phactr4 UTSW 4 132371090 missense probably damaging 1.00
R0317:Phactr4 UTSW 4 132386930 missense probably damaging 1.00
R0961:Phactr4 UTSW 4 132378420 missense probably benign
R1441:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R1443:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R1960:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R1961:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R2145:Phactr4 UTSW 4 132370784 missense probably damaging 0.98
R3077:Phactr4 UTSW 4 132397996 start codon destroyed probably null 0.53
R3423:Phactr4 UTSW 4 132369747 missense probably benign 0.38
R3782:Phactr4 UTSW 4 132367867 unclassified probably null
R3871:Phactr4 UTSW 4 132377249 missense probably benign 0.00
R4427:Phactr4 UTSW 4 132387041 missense possibly damaging 0.90
R4672:Phactr4 UTSW 4 132370706 missense probably damaging 1.00
R4871:Phactr4 UTSW 4 132378448 missense probably damaging 1.00
R5264:Phactr4 UTSW 4 132370982 missense probably damaging 0.99
R5558:Phactr4 UTSW 4 132378455 missense probably damaging 1.00
R5955:Phactr4 UTSW 4 132386909 missense probably damaging 1.00
R6953:Phactr4 UTSW 4 132377351 missense possibly damaging 0.66
R7210:Phactr4 UTSW 4 132358271 makesense probably null
R7286:Phactr4 UTSW 4 132377178 critical splice donor site probably null
R7823:Phactr4 UTSW 4 132361619 nonsense probably null
R7826:Phactr4 UTSW 4 132378441 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- tgcttgcttgcttTCTCAGTgaca -3'
(R):5'- TGGCTCTACCACCGTGACATCT -3'

Sequencing Primer
(F):5'- cgggagacagaggcagg -3'
(R):5'- ACCGTGACATCTGCTGC -3'
Posted On2014-03-14