Mutagenetix > Incidental Mutation

Incidental Mutation 'R1435:Sipa1l2'

159458

Institutional Source

Beutler Lab

Gene Symbol

Sipa1l2

Ensembl Gene

ENSMUSG00000001995

Gene Name

signal-induced proliferation-associated 1 like 2

Synonyms

MMRRC Submission

039490-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.351) question?

Stock #

R1435 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

125418063-125569808 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 125468725 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 758 (V758A)

Ref Sequence

ENSEMBL: ENSMUSP00000148536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]

AlphaFold

Q80TE4

Predicted Effect

probably damaging
Transcript: ENSMUST00000108775
AA Change: V758A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: V758A

Domain	Start	End	E-Value	Type
low complexity region	53	64	N/A	INTRINSIC
low complexity region	163	172	N/A	INTRINSIC
low complexity region	261	272	N/A	INTRINSIC
low complexity region	427	449	N/A	INTRINSIC
Pfam:Rap_GAP	625	807	2.6e-67	PFAM
PDZ	960	1026	6.47e-9	SMART
low complexity region	1091	1103	N/A	INTRINSIC
low complexity region	1120	1138	N/A	INTRINSIC
low complexity region	1220	1238	N/A	INTRINSIC
low complexity region	1299	1312	N/A	INTRINSIC
low complexity region	1321	1329	N/A	INTRINSIC
low complexity region	1334	1355	N/A	INTRINSIC
low complexity region	1404	1418	N/A	INTRINSIC
Pfam:SPAR_C	1421	1666	2.5e-76	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212168
AA Change: V758A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212987
AA Change: V758A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 93.0%
20x: 81.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	A	G	6: 149,326,082	T209A	probably benign	Het
Acadvl	T	G	11: 70,014,816	T62P	probably benign	Het
AF067061	T	A	13: 120,263,988	W63R	probably damaging	Het
Amz1	A	T	5: 140,748,166	N166Y	probably damaging	Het
Anxa6	T	C	11: 54,991,410	Q518R	probably benign	Het
Aox3	G	A	1: 58,163,446		probably null	Het
Arid1a	C	T	4: 133,680,698	R2166Q	unknown	Het
Armc4	T	A	18: 7,222,646	H541L	probably benign	Het
Asb4	T	G	6: 5,398,410	I125S	probably benign	Het
Aspscr1	T	C	11: 120,689,222	S196P	probably benign	Het
Atxn3	A	G	12: 101,942,201	F131L	probably benign	Het
B3gnt5	T	A	16: 19,769,174	Y48N	probably damaging	Het
Bglap3	A	G	3: 88,369,146	M35T	possibly damaging	Het
Cabp1	A	T	5: 115,173,208	D79E	probably damaging	Het
Chd2	C	T	7: 73,453,136	R1367Q	probably damaging	Het
Clec5a	T	A	6: 40,584,424	Q29L	probably damaging	Het
Cmtr2	T	C	8: 110,221,079	L7P	probably benign	Het
Cnbd1	T	C	4: 18,907,026	I183V	probably benign	Het
Col7a1	G	A	9: 108,963,273	G1297D	unknown	Het
Csnk1g3	G	A	18: 53,906,674		probably null	Het
Cyp4a32	A	T	4: 115,606,666	N134I	probably damaging	Het
Cyp4f16	CTATG	CTATGTATG	17: 32,550,734		probably null	Het
Dst	G	A	1: 34,113,945	V56M	probably damaging	Het
Engase	A	T	11: 118,484,901	T32S	probably damaging	Het
Fam117b	T	C	1: 59,969,063	I352T	possibly damaging	Het
Golga4	C	A	9: 118,535,440	D290E	probably benign	Het
Gtf2a1l	C	A	17: 88,694,315	H153N	probably damaging	Het
Hivep1	C	A	13: 42,158,043	T1253N	probably damaging	Het
Hps1	T	C	19: 42,762,275	S398G	probably benign	Het
Il1r2	T	A	1: 40,105,299	F49I	probably damaging	Het
Iqsec1	A	G	6: 90,672,024	S808P	probably damaging	Het
Lrrk1	A	G	7: 66,273,028	L289P	probably damaging	Het
Magi2	T	A	5: 20,358,945	D358E	probably damaging	Het
Man2b2	A	G	5: 36,813,067	W832R	probably damaging	Het
Mfsd4a	G	T	1: 132,067,756	T46K	probably damaging	Het
N4bp3	G	A	11: 51,644,340	R341W	probably damaging	Het
Olfr284	A	T	15: 98,340,328	H220Q	possibly damaging	Het
Olfr568	T	C	7: 102,877,767	S216P	probably damaging	Het
Otof	A	G	5: 30,378,695	L1353S	probably benign	Het
Pcsk5	A	T	19: 17,563,882	C844*	probably null	Het
Pdk2	T	C	11: 95,031,895	Y153C	probably damaging	Het
Pes1	T	C	11: 3,976,075	V292A	probably benign	Het
Pex14	T	C	4: 148,963,527	T198A	probably benign	Het
Phactr4	G	A	4: 132,377,248	T256I	probably benign	Het
Pnpla2	G	A	7: 141,457,411	R109H	probably benign	Het
Polh	G	A	17: 46,194,255	T145I	probably damaging	Het
Polr3d	A	T	14: 70,440,039	V299E	probably benign	Het
Polr3e	C	T	7: 120,940,788	T586M	probably benign	Het
Rbm20	T	A	19: 53,814,157	F365L	probably benign	Het
Rnf213	G	T	11: 119,436,005	C1606F	probably damaging	Het
Slc22a16	T	A	10: 40,587,607	M451K	probably damaging	Het
Slc28a1	T	C	7: 81,153,517	S359P	probably damaging	Het
Slc45a1	G	T	4: 150,644,048	F99L	probably damaging	Het
Sp3	A	T	2: 72,938,156	N754K	possibly damaging	Het
Taf4b	A	T	18: 14,807,409	Q315L	probably damaging	Het
Tmem2	A	T	19: 21,844,706	Q1155L	probably benign	Het
Tmprss15	A	T	16: 79,021,454	N544K	probably benign	Het
Tnfsf13b	A	G	8: 10,035,358	I283V	probably benign	Het
Tnfsf14	T	A	17: 57,190,605	E209V	possibly damaging	Het
Uckl1	T	G	2: 181,573,133	S283R	probably benign	Het
Ush1g	T	C	11: 115,318,468	D300G	probably damaging	Het
Virma	C	T	4: 11,528,621	A1286V	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r59	A	T	7: 42,046,205	M261K	possibly damaging	Het
Vwf	A	T	6: 125,642,249	K1297*	probably null	Het
Zdbf2	G	A	1: 63,303,040	E193K	possibly damaging	Het
Zfp759	T	G	13: 67,138,766	I127S	possibly damaging	Het

Other mutations in Sipa1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00534:Sipa1l2	APN	8	125491806	missense	probably damaging	1.00
IGL00939:Sipa1l2	APN	8	125464435	splice site	probably benign
IGL00965:Sipa1l2	APN	8	125447874	missense	probably benign	0.02
IGL01321:Sipa1l2	APN	8	125491518	missense	probably damaging	1.00
IGL01450:Sipa1l2	APN	8	125422577	critical splice donor site	probably null
IGL01753:Sipa1l2	APN	8	125453292	splice site	probably benign
IGL01930:Sipa1l2	APN	8	125419239	missense	probably damaging	0.99
IGL02041:Sipa1l2	APN	8	125491819	missense	probably benign	0.03
IGL02215:Sipa1l2	APN	8	125447837	missense	possibly damaging	0.67
IGL02272:Sipa1l2	APN	8	125492011	missense	probably damaging	1.00
IGL02370:Sipa1l2	APN	8	125480269	missense	probably damaging	1.00
IGL02538:Sipa1l2	APN	8	125451977	missense	probably damaging	1.00
IGL02633:Sipa1l2	APN	8	125447768	missense	probably damaging	1.00
IGL03394:Sipa1l2	APN	8	125491659	missense	possibly damaging	0.67
Rebellious	UTSW	8	125468339	missense	probably benign	0.01
R0144:Sipa1l2	UTSW	8	125449876	splice site	probably null
R0153:Sipa1l2	UTSW	8	125421898	missense	probably damaging	0.99
R0276:Sipa1l2	UTSW	8	125421940	missense	probably damaging	1.00
R0318:Sipa1l2	UTSW	8	125447697	missense	possibly damaging	0.73
R0373:Sipa1l2	UTSW	8	125464410	missense	probably damaging	0.99
R0427:Sipa1l2	UTSW	8	125480332	missense	probably damaging	1.00
R0634:Sipa1l2	UTSW	8	125422624	nonsense	probably null
R1377:Sipa1l2	UTSW	8	125491977	missense	probably damaging	1.00
R1404:Sipa1l2	UTSW	8	125449973	missense	probably damaging	1.00
R1404:Sipa1l2	UTSW	8	125449973	missense	probably damaging	1.00
R1523:Sipa1l2	UTSW	8	125447613	missense	possibly damaging	0.75
R1577:Sipa1l2	UTSW	8	125492262	missense	probably benign	0.00
R1581:Sipa1l2	UTSW	8	125491617	missense	probably damaging	0.96
R1583:Sipa1l2	UTSW	8	125421895	missense	probably damaging	0.97
R1719:Sipa1l2	UTSW	8	125444535	missense	probably damaging	0.99
R1730:Sipa1l2	UTSW	8	125480141	splice site	probably null
R1940:Sipa1l2	UTSW	8	125480148	splice site	probably benign
R2007:Sipa1l2	UTSW	8	125439437	missense	probably damaging	1.00
R2141:Sipa1l2	UTSW	8	125491491	missense	probably benign	0.07
R2203:Sipa1l2	UTSW	8	125491627	missense	probably damaging	0.99
R2764:Sipa1l2	UTSW	8	125492374	missense	probably damaging	0.99
R3722:Sipa1l2	UTSW	8	125473584	missense	probably damaging	1.00
R3787:Sipa1l2	UTSW	8	125423205	missense	probably benign
R3787:Sipa1l2	UTSW	8	125450383	missense	possibly damaging	0.52
R4106:Sipa1l2	UTSW	8	125492308	missense	probably damaging	1.00
R4117:Sipa1l2	UTSW	8	125468510	missense	probably damaging	1.00
R4194:Sipa1l2	UTSW	8	125491672	missense	probably benign	0.00
R4237:Sipa1l2	UTSW	8	125491656	missense	probably benign	0.44
R4240:Sipa1l2	UTSW	8	125491656	missense	probably benign	0.44
R4448:Sipa1l2	UTSW	8	125492355	missense	probably damaging	1.00
R4515:Sipa1l2	UTSW	8	125492226	missense	probably benign	0.00
R4519:Sipa1l2	UTSW	8	125492226	missense	probably benign	0.00
R4523:Sipa1l2	UTSW	8	125492424	missense	probably damaging	1.00
R4557:Sipa1l2	UTSW	8	125464415	missense	probably damaging	0.98
R4667:Sipa1l2	UTSW	8	125453470	missense	possibly damaging	0.93
R4687:Sipa1l2	UTSW	8	125491245	missense	probably damaging	1.00
R4854:Sipa1l2	UTSW	8	125473601	missense	probably damaging	1.00
R4890:Sipa1l2	UTSW	8	125491867	missense	probably damaging	1.00
R5065:Sipa1l2	UTSW	8	125491585	missense	probably benign	0.19
R5194:Sipa1l2	UTSW	8	125439273	missense	possibly damaging	0.48
R5266:Sipa1l2	UTSW	8	125492126	missense	probably damaging	0.99
R5475:Sipa1l2	UTSW	8	125491595	missense	probably damaging	1.00
R5718:Sipa1l2	UTSW	8	125491248	missense	probably damaging	1.00
R5910:Sipa1l2	UTSW	8	125491684	missense	probably benign	0.42
R5916:Sipa1l2	UTSW	8	125468573	missense	probably damaging	1.00
R5941:Sipa1l2	UTSW	8	125473536	missense	probably damaging	0.99
R6083:Sipa1l2	UTSW	8	125468473	missense	possibly damaging	0.87
R6185:Sipa1l2	UTSW	8	125468253	nonsense	probably null
R6235:Sipa1l2	UTSW	8	125474871	missense	probably damaging	1.00
R6274:Sipa1l2	UTSW	8	125469872	missense	probably damaging	1.00
R6299:Sipa1l2	UTSW	8	125453464	missense	possibly damaging	0.75
R6374:Sipa1l2	UTSW	8	125444630	missense	probably damaging	1.00
R6459:Sipa1l2	UTSW	8	125444484	critical splice donor site	probably null
R6462:Sipa1l2	UTSW	8	125491230	missense	probably damaging	1.00
R6496:Sipa1l2	UTSW	8	125449894	missense	probably benign	0.00
R6543:Sipa1l2	UTSW	8	125450362	missense	possibly damaging	0.50
R7154:Sipa1l2	UTSW	8	125468339	missense	probably benign	0.01
R7192:Sipa1l2	UTSW	8	125422609	missense	probably benign	0.09
R7240:Sipa1l2	UTSW	8	125469860	missense	probably damaging	1.00
R7361:Sipa1l2	UTSW	8	125453332	missense	probably damaging	1.00
R7383:Sipa1l2	UTSW	8	125447646	missense	probably damaging	1.00
R7417:Sipa1l2	UTSW	8	125482106	missense	possibly damaging	0.93
R7604:Sipa1l2	UTSW	8	125419272	missense	probably benign	0.45
R7658:Sipa1l2	UTSW	8	125492290	missense	probably benign	0.00
R7743:Sipa1l2	UTSW	8	125464233	missense	probably damaging	1.00
R7781:Sipa1l2	UTSW	8	125491827	missense	possibly damaging	0.46
R7812:Sipa1l2	UTSW	8	125491595	missense	probably damaging	1.00
R7829:Sipa1l2	UTSW	8	125451988	missense	probably damaging	1.00
R7880:Sipa1l2	UTSW	8	125464393	missense	probably damaging	1.00
R7884:Sipa1l2	UTSW	8	125447598	missense	probably benign
R8057:Sipa1l2	UTSW	8	125468530	missense	probably damaging	1.00
R8082:Sipa1l2	UTSW	8	125491809	missense	possibly damaging	0.82
R8092:Sipa1l2	UTSW	8	125419168	missense	probably benign	0.03
R8247:Sipa1l2	UTSW	8	125422633	missense	probably benign	0.29
R8252:Sipa1l2	UTSW	8	125468671	missense	probably damaging	1.00
R8386:Sipa1l2	UTSW	8	125492093	missense	probably damaging	1.00
R8466:Sipa1l2	UTSW	8	125492246	missense	probably damaging	1.00
R8697:Sipa1l2	UTSW	8	125482116	missense	probably damaging	1.00
R8725:Sipa1l2	UTSW	8	125450386	missense	probably benign	0.28
R8727:Sipa1l2	UTSW	8	125450386	missense	probably benign	0.28
R9048:Sipa1l2	UTSW	8	125447726	missense	possibly damaging	0.59
R9224:Sipa1l2	UTSW	8	125491977	missense	probably damaging	1.00
R9279:Sipa1l2	UTSW	8	125482157	missense	probably damaging	1.00
R9392:Sipa1l2	UTSW	8	125468221	missense	probably benign
R9574:Sipa1l2	UTSW	8	125442714	missense	probably benign
R9591:Sipa1l2	UTSW	8	125492373	missense	probably damaging	0.99
R9614:Sipa1l2	UTSW	8	125469826	missense	probably null	0.01
R9690:Sipa1l2	UTSW	8	125492257	missense	probably benign
X0027:Sipa1l2	UTSW	8	125492136	missense	probably damaging	1.00
Z1177:Sipa1l2	UTSW	8	125447556	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- CCAGCGTGATGAAGCTGAATTTTGC -3'
(R):5'- GAGCCCAAGACCGTCTTTGTTAGG -3'

Sequencing Primer
(F):5'- GTGACAAAGTTCTCGGCTAAATCC -3'
(R):5'- ATGTATGGGTACACACCTGC -3'

Posted On

2014-03-14