Incidental Mutation 'R1435:Atxn3'
ID159474
Institutional Source Beutler Lab
Gene Symbol Atxn3
Ensembl Gene ENSMUSG00000021189
Gene Nameataxin 3
SynonymsSca3, ataxin-3, Atx3, MJD1, 2210008M02Rik, Mjd
MMRRC Submission 039490-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1435 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location101918901-101958246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101942201 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 131 (F131L)
Ref Sequence ENSEMBL: ENSMUSP00000021606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021606] [ENSMUST00000159883] [ENSMUST00000160251] [ENSMUST00000161011]
Predicted Effect probably benign
Transcript: ENSMUST00000021606
AA Change: F131L

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021606
Gene: ENSMUSG00000021189
AA Change: F131L

DomainStartEndE-ValueType
Josephin 8 168 1.6e-91 SMART
UIM 224 243 2.23e-1 SMART
UIM 244 263 1.51e-3 SMART
low complexity region 276 286 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
UIM 329 348 7.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159883
AA Change: F127L

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124419
Gene: ENSMUSG00000021189
AA Change: F127L

DomainStartEndE-ValueType
Josephin 5 164 1.1e-89 SMART
UIM 220 239 2.23e-1 SMART
UIM 240 259 1.51e-3 SMART
low complexity region 272 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160251
AA Change: F131L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000125082
Gene: ENSMUSG00000021189
AA Change: F131L

DomainStartEndE-ValueType
Josephin 8 168 1.6e-91 SMART
UIM 224 243 2.23e-1 SMART
UIM 244 263 8.77e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161011
AA Change: F131L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125378
Gene: ENSMUSG00000021189
AA Change: F131L

DomainStartEndE-ValueType
Josephin 8 168 1.6e-91 SMART
UIM 224 243 2.23e-1 SMART
UIM 244 263 1.51e-3 SMART
low complexity region 276 286 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.0%
  • 20x: 81.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Machado-Joseph disease, also known as spinocerebellar ataxia-3, is an autosomal dominant neurologic disorder. The protein encoded by this gene contains (CAG)n repeats in the coding region, and the expansion of these repeats from the normal 12-44 to 52-86 is one cause of Machado-Joseph disease. There is a negative correlation between the age of onset and CAG repeat numbers. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Decreased exploratory behavior is reported for mice homozygous for a disruption of this marker. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,326,082 T209A probably benign Het
Acadvl T G 11: 70,014,816 T62P probably benign Het
AF067061 T A 13: 120,263,988 W63R probably damaging Het
Amz1 A T 5: 140,748,166 N166Y probably damaging Het
Anxa6 T C 11: 54,991,410 Q518R probably benign Het
Aox3 G A 1: 58,163,446 probably null Het
Arid1a C T 4: 133,680,698 R2166Q unknown Het
Armc4 T A 18: 7,222,646 H541L probably benign Het
Asb4 T G 6: 5,398,410 I125S probably benign Het
Aspscr1 T C 11: 120,689,222 S196P probably benign Het
B3gnt5 T A 16: 19,769,174 Y48N probably damaging Het
Bglap3 A G 3: 88,369,146 M35T possibly damaging Het
Cabp1 A T 5: 115,173,208 D79E probably damaging Het
Chd2 C T 7: 73,453,136 R1367Q probably damaging Het
Clec5a T A 6: 40,584,424 Q29L probably damaging Het
Cmtr2 T C 8: 110,221,079 L7P probably benign Het
Cnbd1 T C 4: 18,907,026 I183V probably benign Het
Col7a1 G A 9: 108,963,273 G1297D unknown Het
Csnk1g3 G A 18: 53,906,674 probably null Het
Cyp4a32 A T 4: 115,606,666 N134I probably damaging Het
Cyp4f16 CTATG CTATGTATG 17: 32,550,734 probably null Het
Dst G A 1: 34,113,945 V56M probably damaging Het
Engase A T 11: 118,484,901 T32S probably damaging Het
Fam117b T C 1: 59,969,063 I352T possibly damaging Het
Golga4 C A 9: 118,535,440 D290E probably benign Het
Gtf2a1l C A 17: 88,694,315 H153N probably damaging Het
Hivep1 C A 13: 42,158,043 T1253N probably damaging Het
Hps1 T C 19: 42,762,275 S398G probably benign Het
Il1r2 T A 1: 40,105,299 F49I probably damaging Het
Iqsec1 A G 6: 90,672,024 S808P probably damaging Het
Lrrk1 A G 7: 66,273,028 L289P probably damaging Het
Magi2 T A 5: 20,358,945 D358E probably damaging Het
Man2b2 A G 5: 36,813,067 W832R probably damaging Het
Mfsd4a G T 1: 132,067,756 T46K probably damaging Het
N4bp3 G A 11: 51,644,340 R341W probably damaging Het
Olfr284 A T 15: 98,340,328 H220Q possibly damaging Het
Olfr568 T C 7: 102,877,767 S216P probably damaging Het
Otof A G 5: 30,378,695 L1353S probably benign Het
Pcsk5 A T 19: 17,563,882 C844* probably null Het
Pdk2 T C 11: 95,031,895 Y153C probably damaging Het
Pes1 T C 11: 3,976,075 V292A probably benign Het
Pex14 T C 4: 148,963,527 T198A probably benign Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pnpla2 G A 7: 141,457,411 R109H probably benign Het
Polh G A 17: 46,194,255 T145I probably damaging Het
Polr3d A T 14: 70,440,039 V299E probably benign Het
Polr3e C T 7: 120,940,788 T586M probably benign Het
Rbm20 T A 19: 53,814,157 F365L probably benign Het
Rnf213 G T 11: 119,436,005 C1606F probably damaging Het
Sipa1l2 A G 8: 125,468,725 V758A probably damaging Het
Slc22a16 T A 10: 40,587,607 M451K probably damaging Het
Slc28a1 T C 7: 81,153,517 S359P probably damaging Het
Slc45a1 G T 4: 150,644,048 F99L probably damaging Het
Sp3 A T 2: 72,938,156 N754K possibly damaging Het
Taf4b A T 18: 14,807,409 Q315L probably damaging Het
Tmem2 A T 19: 21,844,706 Q1155L probably benign Het
Tmprss15 A T 16: 79,021,454 N544K probably benign Het
Tnfsf13b A G 8: 10,035,358 I283V probably benign Het
Tnfsf14 T A 17: 57,190,605 E209V possibly damaging Het
Uckl1 T G 2: 181,573,133 S283R probably benign Het
Ush1g T C 11: 115,318,468 D300G probably damaging Het
Virma C T 4: 11,528,621 A1286V probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r59 A T 7: 42,046,205 M261K possibly damaging Het
Vwf A T 6: 125,642,249 K1297* probably null Het
Zdbf2 G A 1: 63,303,040 E193K possibly damaging Het
Zfp759 T G 13: 67,138,766 I127S possibly damaging Het
Other mutations in Atxn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Atxn3 APN 12 101926508 missense possibly damaging 0.94
IGL01364:Atxn3 APN 12 101934423 splice site probably benign
IGL01393:Atxn3 APN 12 101933047 nonsense probably null
IGL01994:Atxn3 APN 12 101942180 missense probably benign
IGL03214:Atxn3 APN 12 101945922 splice site probably benign
R1081:Atxn3 UTSW 12 101934349 missense probably damaging 0.98
R1255:Atxn3 UTSW 12 101934334 missense probably damaging 1.00
R1288:Atxn3 UTSW 12 101942178 synonymous probably null
R1466:Atxn3 UTSW 12 101926499 missense possibly damaging 0.73
R1466:Atxn3 UTSW 12 101926499 missense possibly damaging 0.73
R2032:Atxn3 UTSW 12 101942194 nonsense probably null
R2345:Atxn3 UTSW 12 101948321 missense probably damaging 1.00
R2882:Atxn3 UTSW 12 101937411 missense probably damaging 1.00
R4593:Atxn3 UTSW 12 101923177 missense probably benign 0.01
R4628:Atxn3 UTSW 12 101923078 unclassified probably benign
R4849:Atxn3 UTSW 12 101934368 missense probably benign 0.02
R4876:Atxn3 UTSW 12 101948379 missense probably damaging 1.00
R4960:Atxn3 UTSW 12 101948379 missense possibly damaging 0.92
R5682:Atxn3 UTSW 12 101958147 missense probably damaging 1.00
R6010:Atxn3 UTSW 12 101948026 missense probably damaging 1.00
R6520:Atxn3 UTSW 12 101934401 missense probably damaging 1.00
R6629:Atxn3 UTSW 12 101937406 missense probably benign 0.11
R7460:Atxn3 UTSW 12 101926517 missense probably benign 0.15
R7546:Atxn3 UTSW 12 101948002 critical splice donor site probably null
X0061:Atxn3 UTSW 12 101958139 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACTCACATAGAACTGCGTCACTC -3'
(R):5'- TGTTGGCCTGACAGTGTAAAACCTC -3'

Sequencing Primer
(F):5'- TCACAAATCGGAGACCAGTG -3'
(R):5'- aaatccttctgcctctgcc -3'
Posted On2014-03-14