Incidental Mutation 'R1435:Gtf2a1l'
ID159487
Institutional Source Beutler Lab
Gene Symbol Gtf2a1l
Ensembl Gene ENSMUSG00000024154
Gene Namegeneral transcription factor IIA, 1-like
SynonymsGtf2a1lf, 1700011N16Rik, Alf
MMRRC Submission 039490-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock #R1435 (G1)
Quality Score146
Status Not validated
Chromosome17
Chromosomal Location88668660-88715152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88694315 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 153 (H153N)
Ref Sequence ENSEMBL: ENSMUSP00000124286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024970] [ENSMUST00000161481]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024970
AA Change: H200N

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024970
Gene: ENSMUSG00000024154
AA Change: H200N

DomainStartEndE-ValueType
TFIIA 9 468 6.87e-202 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161481
AA Change: H153N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124286
Gene: ENSMUSG00000024154
AA Change: H153N

DomainStartEndE-ValueType
Pfam:TFIIA 9 76 3.2e-29 PFAM
Pfam:TFIIA 70 243 3e-13 PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.0%
  • 20x: 81.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The assembly and stability of the RNA polymerase II transcription pre-initiation complex on a eukaryotic core promoter involve the effects of transcription factor IIA (TFIIA) on the interaction between TATA-binding protein (TBP) and DNA. This gene encodes a germ cell-specific counterpart of the large (alpha/beta) subunit of general transcription factor TFIIA that is able to stabilize the binding of TBP to DNA and may be uniquely important to testis biology. Alternative splicing for this locus has been observed and two variants, encoding distinct isoforms, have been identified. Co-transcription of this gene and the neighboring upstream gene generates a rare transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,326,082 T209A probably benign Het
Acadvl T G 11: 70,014,816 T62P probably benign Het
AF067061 T A 13: 120,263,988 W63R probably damaging Het
Amz1 A T 5: 140,748,166 N166Y probably damaging Het
Anxa6 T C 11: 54,991,410 Q518R probably benign Het
Aox3 G A 1: 58,163,446 probably null Het
Arid1a C T 4: 133,680,698 R2166Q unknown Het
Armc4 T A 18: 7,222,646 H541L probably benign Het
Asb4 T G 6: 5,398,410 I125S probably benign Het
Aspscr1 T C 11: 120,689,222 S196P probably benign Het
Atxn3 A G 12: 101,942,201 F131L probably benign Het
B3gnt5 T A 16: 19,769,174 Y48N probably damaging Het
Bglap3 A G 3: 88,369,146 M35T possibly damaging Het
Cabp1 A T 5: 115,173,208 D79E probably damaging Het
Chd2 C T 7: 73,453,136 R1367Q probably damaging Het
Clec5a T A 6: 40,584,424 Q29L probably damaging Het
Cmtr2 T C 8: 110,221,079 L7P probably benign Het
Cnbd1 T C 4: 18,907,026 I183V probably benign Het
Col7a1 G A 9: 108,963,273 G1297D unknown Het
Csnk1g3 G A 18: 53,906,674 probably null Het
Cyp4a32 A T 4: 115,606,666 N134I probably damaging Het
Cyp4f16 CTATG CTATGTATG 17: 32,550,734 probably null Het
Dst G A 1: 34,113,945 V56M probably damaging Het
Engase A T 11: 118,484,901 T32S probably damaging Het
Fam117b T C 1: 59,969,063 I352T possibly damaging Het
Golga4 C A 9: 118,535,440 D290E probably benign Het
Hivep1 C A 13: 42,158,043 T1253N probably damaging Het
Hps1 T C 19: 42,762,275 S398G probably benign Het
Il1r2 T A 1: 40,105,299 F49I probably damaging Het
Iqsec1 A G 6: 90,672,024 S808P probably damaging Het
Lrrk1 A G 7: 66,273,028 L289P probably damaging Het
Magi2 T A 5: 20,358,945 D358E probably damaging Het
Man2b2 A G 5: 36,813,067 W832R probably damaging Het
Mfsd4a G T 1: 132,067,756 T46K probably damaging Het
N4bp3 G A 11: 51,644,340 R341W probably damaging Het
Olfr284 A T 15: 98,340,328 H220Q possibly damaging Het
Olfr568 T C 7: 102,877,767 S216P probably damaging Het
Otof A G 5: 30,378,695 L1353S probably benign Het
Pcsk5 A T 19: 17,563,882 C844* probably null Het
Pdk2 T C 11: 95,031,895 Y153C probably damaging Het
Pes1 T C 11: 3,976,075 V292A probably benign Het
Pex14 T C 4: 148,963,527 T198A probably benign Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pnpla2 G A 7: 141,457,411 R109H probably benign Het
Polh G A 17: 46,194,255 T145I probably damaging Het
Polr3d A T 14: 70,440,039 V299E probably benign Het
Polr3e C T 7: 120,940,788 T586M probably benign Het
Rbm20 T A 19: 53,814,157 F365L probably benign Het
Rnf213 G T 11: 119,436,005 C1606F probably damaging Het
Sipa1l2 A G 8: 125,468,725 V758A probably damaging Het
Slc22a16 T A 10: 40,587,607 M451K probably damaging Het
Slc28a1 T C 7: 81,153,517 S359P probably damaging Het
Slc45a1 G T 4: 150,644,048 F99L probably damaging Het
Sp3 A T 2: 72,938,156 N754K possibly damaging Het
Taf4b A T 18: 14,807,409 Q315L probably damaging Het
Tmem2 A T 19: 21,844,706 Q1155L probably benign Het
Tmprss15 A T 16: 79,021,454 N544K probably benign Het
Tnfsf13b A G 8: 10,035,358 I283V probably benign Het
Tnfsf14 T A 17: 57,190,605 E209V possibly damaging Het
Uckl1 T G 2: 181,573,133 S283R probably benign Het
Ush1g T C 11: 115,318,468 D300G probably damaging Het
Virma C T 4: 11,528,621 A1286V probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r59 A T 7: 42,046,205 M261K possibly damaging Het
Vwf A T 6: 125,642,249 K1297* probably null Het
Zdbf2 G A 1: 63,303,040 E193K possibly damaging Het
Zfp759 T G 13: 67,138,766 I127S possibly damaging Het
Other mutations in Gtf2a1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Gtf2a1l APN 17 88694295 missense probably damaging 1.00
IGL00928:Gtf2a1l APN 17 88694462 missense probably benign 0.09
IGL00974:Gtf2a1l APN 17 88714949 missense probably damaging 1.00
IGL01024:Gtf2a1l APN 17 88671291 missense probably damaging 1.00
IGL02429:Gtf2a1l APN 17 88668713 start codon destroyed probably null 0.61
IGL02658:Gtf2a1l APN 17 88668718 missense probably benign 0.01
IGL03377:Gtf2a1l APN 17 88711593 missense probably benign 0.03
R0848:Gtf2a1l UTSW 17 88694229 missense probably damaging 0.99
R0899:Gtf2a1l UTSW 17 88668724 missense possibly damaging 0.56
R1716:Gtf2a1l UTSW 17 88694580 missense probably benign 0.06
R1861:Gtf2a1l UTSW 17 88714954 missense probably damaging 1.00
R2301:Gtf2a1l UTSW 17 88711472 missense probably benign
R2906:Gtf2a1l UTSW 17 88694655 missense possibly damaging 0.92
R4281:Gtf2a1l UTSW 17 88711637 missense possibly damaging 0.95
R4289:Gtf2a1l UTSW 17 88694456 missense probably damaging 0.98
R4771:Gtf2a1l UTSW 17 88690020 missense probably benign 0.23
R4904:Gtf2a1l UTSW 17 88690043 critical splice donor site probably null
R4941:Gtf2a1l UTSW 17 88714922 missense probably damaging 1.00
R5106:Gtf2a1l UTSW 17 88694645 missense possibly damaging 0.95
R6003:Gtf2a1l UTSW 17 88694103 missense probably damaging 1.00
R6035:Gtf2a1l UTSW 17 88711534 missense probably benign 0.00
R6035:Gtf2a1l UTSW 17 88711534 missense probably benign 0.00
R6128:Gtf2a1l UTSW 17 88694658 missense probably null 0.94
R6246:Gtf2a1l UTSW 17 88671547 missense probably benign 0.09
R6481:Gtf2a1l UTSW 17 88711625 missense probably benign 0.09
R7344:Gtf2a1l UTSW 17 88694103 missense probably damaging 1.00
R7462:Gtf2a1l UTSW 17 88694138 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TCCAGCATCCATTTCAGCAAGTCC -3'
(R):5'- ATGCGAAGCCCTACCTTCTCTGAC -3'

Sequencing Primer
(F):5'- ATTTCAGCAAGTCCTTCAGCAG -3'
(R):5'- GTGGAGTCGCATCCATATATACTGTC -3'
Posted On2014-03-14