Incidental Mutation 'R1435:Rbm20'
ID159494
Institutional Source Beutler Lab
Gene Symbol Rbm20
Ensembl Gene ENSMUSG00000043639
Gene NameRNA binding motif protein 20
Synonyms2010003H22Rik, 1110018J23Rik
MMRRC Submission 039490-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R1435 (G1)
Quality Score197
Status Not validated
Chromosome19
Chromosomal Location53677306-53867080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53814157 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 365 (F365L)
Ref Sequence ENSEMBL: ENSMUSP00000093665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095969] [ENSMUST00000164202]
Predicted Effect probably benign
Transcript: ENSMUST00000095969
AA Change: F365L

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093665
Gene: ENSMUSG00000043639
AA Change: F365L

DomainStartEndE-ValueType
low complexity region 25 61 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
ZnF_C2H2 413 437 4.69e0 SMART
RRM 521 591 4.01e-5 SMART
low complexity region 634 657 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162910
Predicted Effect probably benign
Transcript: ENSMUST00000164202
AA Change: F365L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129447
Gene: ENSMUSG00000043639
AA Change: F365L

DomainStartEndE-ValueType
low complexity region 25 61 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
ZnF_U1 410 444 6.79e-1 SMART
ZnF_C2H2 413 437 4.69e0 SMART
RRM 521 591 4.01e-5 SMART
low complexity region 634 657 N/A INTRINSIC
low complexity region 804 815 N/A INTRINSIC
low complexity region 833 844 N/A INTRINSIC
ZnF_U1 1130 1165 7.26e-6 SMART
ZnF_C2H2 1133 1158 3.13e1 SMART
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.0%
  • 20x: 81.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds RNA and regulates splicing. Mutations in this gene have been associated with familial dilated cardiomyopathy. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for an allele lacking the RNA recognition motif exhibit increased titin compliance, and attenuated Frank-Starling mechanism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,326,082 T209A probably benign Het
Acadvl T G 11: 70,014,816 T62P probably benign Het
AF067061 T A 13: 120,263,988 W63R probably damaging Het
Amz1 A T 5: 140,748,166 N166Y probably damaging Het
Anxa6 T C 11: 54,991,410 Q518R probably benign Het
Aox3 G A 1: 58,163,446 probably null Het
Arid1a C T 4: 133,680,698 R2166Q unknown Het
Armc4 T A 18: 7,222,646 H541L probably benign Het
Asb4 T G 6: 5,398,410 I125S probably benign Het
Aspscr1 T C 11: 120,689,222 S196P probably benign Het
Atxn3 A G 12: 101,942,201 F131L probably benign Het
B3gnt5 T A 16: 19,769,174 Y48N probably damaging Het
Bglap3 A G 3: 88,369,146 M35T possibly damaging Het
Cabp1 A T 5: 115,173,208 D79E probably damaging Het
Chd2 C T 7: 73,453,136 R1367Q probably damaging Het
Clec5a T A 6: 40,584,424 Q29L probably damaging Het
Cmtr2 T C 8: 110,221,079 L7P probably benign Het
Cnbd1 T C 4: 18,907,026 I183V probably benign Het
Col7a1 G A 9: 108,963,273 G1297D unknown Het
Csnk1g3 G A 18: 53,906,674 probably null Het
Cyp4a32 A T 4: 115,606,666 N134I probably damaging Het
Cyp4f16 CTATG CTATGTATG 17: 32,550,734 probably null Het
Dst G A 1: 34,113,945 V56M probably damaging Het
Engase A T 11: 118,484,901 T32S probably damaging Het
Fam117b T C 1: 59,969,063 I352T possibly damaging Het
Golga4 C A 9: 118,535,440 D290E probably benign Het
Gtf2a1l C A 17: 88,694,315 H153N probably damaging Het
Hivep1 C A 13: 42,158,043 T1253N probably damaging Het
Hps1 T C 19: 42,762,275 S398G probably benign Het
Il1r2 T A 1: 40,105,299 F49I probably damaging Het
Iqsec1 A G 6: 90,672,024 S808P probably damaging Het
Lrrk1 A G 7: 66,273,028 L289P probably damaging Het
Magi2 T A 5: 20,358,945 D358E probably damaging Het
Man2b2 A G 5: 36,813,067 W832R probably damaging Het
Mfsd4a G T 1: 132,067,756 T46K probably damaging Het
N4bp3 G A 11: 51,644,340 R341W probably damaging Het
Olfr284 A T 15: 98,340,328 H220Q possibly damaging Het
Olfr568 T C 7: 102,877,767 S216P probably damaging Het
Otof A G 5: 30,378,695 L1353S probably benign Het
Pcsk5 A T 19: 17,563,882 C844* probably null Het
Pdk2 T C 11: 95,031,895 Y153C probably damaging Het
Pes1 T C 11: 3,976,075 V292A probably benign Het
Pex14 T C 4: 148,963,527 T198A probably benign Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pnpla2 G A 7: 141,457,411 R109H probably benign Het
Polh G A 17: 46,194,255 T145I probably damaging Het
Polr3d A T 14: 70,440,039 V299E probably benign Het
Polr3e C T 7: 120,940,788 T586M probably benign Het
Rnf213 G T 11: 119,436,005 C1606F probably damaging Het
Sipa1l2 A G 8: 125,468,725 V758A probably damaging Het
Slc22a16 T A 10: 40,587,607 M451K probably damaging Het
Slc28a1 T C 7: 81,153,517 S359P probably damaging Het
Slc45a1 G T 4: 150,644,048 F99L probably damaging Het
Sp3 A T 2: 72,938,156 N754K possibly damaging Het
Taf4b A T 18: 14,807,409 Q315L probably damaging Het
Tmem2 A T 19: 21,844,706 Q1155L probably benign Het
Tmprss15 A T 16: 79,021,454 N544K probably benign Het
Tnfsf13b A G 8: 10,035,358 I283V probably benign Het
Tnfsf14 T A 17: 57,190,605 E209V possibly damaging Het
Uckl1 T G 2: 181,573,133 S283R probably benign Het
Ush1g T C 11: 115,318,468 D300G probably damaging Het
Virma C T 4: 11,528,621 A1286V probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r59 A T 7: 42,046,205 M261K possibly damaging Het
Vwf A T 6: 125,642,249 K1297* probably null Het
Zdbf2 G A 1: 63,303,040 E193K possibly damaging Het
Zfp759 T G 13: 67,138,766 I127S possibly damaging Het
Other mutations in Rbm20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rbm20 APN 19 53843264 missense probably damaging 1.00
IGL00815:Rbm20 APN 19 53815517 missense probably damaging 1.00
IGL00845:Rbm20 APN 19 53817949 missense probably damaging 1.00
IGL01408:Rbm20 APN 19 53851613 missense possibly damaging 0.95
IGL01663:Rbm20 APN 19 53840995 missense probably damaging 1.00
IGL01902:Rbm20 APN 19 53840991 missense probably damaging 0.99
IGL01942:Rbm20 APN 19 53813443 missense probably damaging 1.00
IGL02964:Rbm20 APN 19 53813702 missense probably benign 0.02
IGL03326:Rbm20 APN 19 53814000 missense possibly damaging 0.85
BB001:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
BB002:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
BB011:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
BB012:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
R0326:Rbm20 UTSW 19 53864165 missense probably damaging 1.00
R0487:Rbm20 UTSW 19 53851195 missense probably damaging 1.00
R0965:Rbm20 UTSW 19 53859401 missense probably damaging 1.00
R1914:Rbm20 UTSW 19 53864087 missense probably damaging 1.00
R1915:Rbm20 UTSW 19 53864087 missense probably damaging 1.00
R2011:Rbm20 UTSW 19 53859428 missense probably damaging 1.00
R2012:Rbm20 UTSW 19 53859428 missense probably damaging 1.00
R2258:Rbm20 UTSW 19 53851741 missense probably benign
R3947:Rbm20 UTSW 19 53813337 missense probably benign 0.35
R4305:Rbm20 UTSW 19 53843260 missense probably damaging 1.00
R4308:Rbm20 UTSW 19 53843260 missense probably damaging 1.00
R4521:Rbm20 UTSW 19 53817202 missense probably benign 0.14
R4970:Rbm20 UTSW 19 53851669 missense probably damaging 0.99
R5266:Rbm20 UTSW 19 53813387 missense probably damaging 1.00
R5475:Rbm20 UTSW 19 53834705 nonsense probably null
R5503:Rbm20 UTSW 19 53851354 missense possibly damaging 0.75
R5995:Rbm20 UTSW 19 53851267 missense possibly damaging 0.95
R6836:Rbm20 UTSW 19 53814069 missense probably damaging 0.98
R6947:Rbm20 UTSW 19 53851265 missense probably damaging 1.00
R7030:Rbm20 UTSW 19 53834766 missense probably damaging 1.00
R7117:Rbm20 UTSW 19 53851558 missense possibly damaging 0.92
R7237:Rbm20 UTSW 19 53851499 missense probably benign 0.04
R7638:Rbm20 UTSW 19 53814333 missense possibly damaging 0.95
R7792:Rbm20 UTSW 19 53850136 missense probably benign
R7823:Rbm20 UTSW 19 53843354 missense probably benign 0.33
R7924:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
R7925:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
R8044:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8045:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8046:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8100:Rbm20 UTSW 19 53851313 missense possibly damaging 0.85
R8292:Rbm20 UTSW 19 53851499 missense possibly damaging 0.71
R8366:Rbm20 UTSW 19 53850181 missense possibly damaging 0.95
R8518:Rbm20 UTSW 19 53851492 missense probably benign 0.18
RF016:Rbm20 UTSW 19 53813732 missense probably benign 0.00
Z1177:Rbm20 UTSW 19 53851685 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACATAGCAGGTGGATTTCCAGC -3'
(R):5'- GGCCTACGATTCTCATAAAGGGCAC -3'

Sequencing Primer
(F):5'- TGATCAGACTGGGAGCATGAAG -3'
(R):5'- CAAAGGGACTTCTCTTAGATGCC -3'
Posted On2014-03-14