Incidental Mutation 'R1436:Nckap5'
ID159497
Institutional Source Beutler Lab
Gene Symbol Nckap5
Ensembl Gene ENSMUSG00000049690
Gene NameNCK-associated protein 5
SynonymsE030049G20Rik, LOC380609, D130011D22Rik
MMRRC Submission 039491-MU
Accession Numbers

Genbank: NM_001081756, NM_172484, NM_176957

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1436 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location125913620-126830799 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126026061 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 854 (Y854C)
Ref Sequence ENSEMBL: ENSMUSP00000062229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057846] [ENSMUST00000094609] [ENSMUST00000094610] [ENSMUST00000112583] [ENSMUST00000161954] [ENSMUST00000162877]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057846
AA Change: Y854C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000062229
Gene: ENSMUSG00000049690
AA Change: Y854C

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 950 971 N/A INTRINSIC
low complexity region 1070 1085 N/A INTRINSIC
low complexity region 1181 1200 N/A INTRINSIC
Pfam:NCKAP5 1298 1602 1.8e-120 PFAM
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1757 1771 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094609
SMART Domains Protein: ENSMUSP00000092192
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
Pfam:NCKAP5 113 364 3.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094610
SMART Domains Protein: ENSMUSP00000092193
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 1 101 8.8e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112583
AA Change: Y986C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108202
Gene: ENSMUSG00000049690
AA Change: Y986C

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
coiled coil region 176 254 N/A INTRINSIC
low complexity region 301 324 N/A INTRINSIC
low complexity region 453 464 N/A INTRINSIC
low complexity region 887 903 N/A INTRINSIC
low complexity region 1082 1103 N/A INTRINSIC
low complexity region 1202 1217 N/A INTRINSIC
low complexity region 1313 1332 N/A INTRINSIC
Pfam:NCKAP5 1431 1733 5.3e-119 PFAM
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1889 1903 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159934
Predicted Effect probably benign
Transcript: ENSMUST00000161954
AA Change: Y918C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125624
Gene: ENSMUSG00000049690
AA Change: Y918C

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 233 256 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
low complexity region 1014 1035 N/A INTRINSIC
low complexity region 1134 1149 N/A INTRINSIC
low complexity region 1245 1264 N/A INTRINSIC
Pfam:NCKAP5 1362 1666 2.1e-120 PFAM
low complexity region 1792 1806 N/A INTRINSIC
low complexity region 1821 1835 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162877
SMART Domains Protein: ENSMUSP00000124748
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 9 296 6e-36 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency 94% (65/69)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,644,213 F292S probably benign Het
Abca13 T C 11: 9,292,646 V1503A probably damaging Het
AI661453 C T 17: 47,466,702 probably benign Het
Ano2 T C 6: 125,867,171 probably null Het
Areg G T 5: 91,139,805 probably benign Het
Atg16l2 A G 7: 101,291,550 V453A probably damaging Het
BC034090 A G 1: 155,225,916 S563P probably benign Het
Bhmt-ps1 A G 4: 26,369,591 noncoding transcript Het
Birc6 C A 17: 74,652,705 P3855Q probably damaging Het
Cd151 A T 7: 141,469,284 K8M probably damaging Het
Cd163 T C 6: 124,327,931 V1089A possibly damaging Het
Chd3 A T 11: 69,357,574 probably null Het
Cnot6l T A 5: 96,134,112 E9V probably damaging Het
Col22a1 A G 15: 71,922,957 probably benign Het
Cyp2c68 A G 19: 39,741,040 M1T probably null Het
Dbp T C 7: 45,708,455 V149A probably damaging Het
Dnah10 T C 5: 124,762,221 V1241A probably benign Het
Galnt10 T C 11: 57,771,469 S314P probably damaging Het
Glce C T 9: 62,070,010 probably null Het
Gm5093 C G 17: 46,439,754 D116H probably damaging Het
Gm8298 A T 3: 59,865,339 D88V probably damaging Het
Golim4 A G 3: 75,878,644 probably null Het
Helz2 A T 2: 181,235,524 I1107N probably damaging Het
Hoxc9 T C 15: 102,981,872 S74P probably benign Het
Ikbkb T A 8: 22,673,403 N297I probably benign Het
Il20ra T A 10: 19,749,252 I93N probably damaging Het
Itch C A 2: 155,192,145 N412K probably damaging Het
Kcna5 T A 6: 126,534,761 T135S probably damaging Het
Lncpint G A 6: 31,181,039 noncoding transcript Het
Lrrc39 A T 3: 116,579,644 probably null Het
Mad2l1 T A 6: 66,539,813 V163E possibly damaging Het
Moxd1 C T 10: 24,244,358 T128M probably damaging Het
Mpeg1 C T 19: 12,462,459 S427F probably damaging Het
Ncln C T 10: 81,489,893 E373K probably damaging Het
Neurod4 T C 10: 130,270,671 T245A possibly damaging Het
Nsun5 T C 5: 135,370,213 L39P probably damaging Het
Olfr1202 A T 2: 88,817,992 T274S possibly damaging Het
Olfr1303 A G 2: 111,814,561 L55S probably damaging Het
Olfr1368 G T 13: 21,142,992 Q22K probably benign Het
Pde8b T C 13: 95,026,170 T815A probably benign Het
Pofut2 C T 10: 77,268,564 R392W probably damaging Het
Ppip5k2 G A 1: 97,711,782 T1186I probably benign Het
Rhot2 A C 17: 25,841,400 S277R probably benign Het
Satb1 T G 17: 51,804,363 probably null Het
Sec31b T C 19: 44,536,195 I88V probably damaging Het
Selenon T A 4: 134,540,686 E483V probably damaging Het
Serpinc1 A G 1: 160,993,411 T22A possibly damaging Het
Sf3a2 G A 10: 80,804,206 probably benign Het
Sf3b1 A G 1: 55,001,421 Y561H possibly damaging Het
Smarcc1 T A 9: 110,118,640 probably benign Het
Stard3nl C T 13: 19,372,649 R107Q probably damaging Het
Syce1 C T 7: 140,777,680 R324H possibly damaging Het
Tnk1 G T 11: 69,852,293 probably benign Het
Trim46 A G 3: 89,243,661 F198L probably damaging Het
Trip4 A T 9: 65,880,951 W71R probably damaging Het
Ubox5 A C 2: 130,597,293 probably benign Het
Ust G A 10: 8,307,438 T167M probably damaging Het
Zbtb2 T C 10: 4,368,697 Q443R probably benign Het
Zfp407 A G 18: 84,343,071 probably benign Het
Other mutations in Nckap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nckap5 APN 1 126027152 missense probably damaging 0.99
IGL00956:Nckap5 APN 1 126025018 missense probably damaging 0.98
IGL01414:Nckap5 APN 1 126528713 missense probably damaging 1.00
IGL01482:Nckap5 APN 1 126023160 missense probably damaging 1.00
IGL01508:Nckap5 APN 1 126025572 missense probably damaging 0.96
IGL02071:Nckap5 APN 1 125981568 missense probably damaging 0.97
IGL02129:Nckap5 APN 1 126027695 nonsense probably null
IGL02821:Nckap5 APN 1 126027816 missense probably damaging 1.00
IGL03174:Nckap5 APN 1 125981646 missense probably damaging 1.00
F5493:Nckap5 UTSW 1 126025827 missense probably benign
G5030:Nckap5 UTSW 1 126025854 missense probably damaging 0.96
R0033:Nckap5 UTSW 1 125940242 intron probably benign
R0164:Nckap5 UTSW 1 126024407 missense possibly damaging 0.84
R0164:Nckap5 UTSW 1 126024407 missense possibly damaging 0.84
R0349:Nckap5 UTSW 1 126026434 missense probably benign
R0482:Nckap5 UTSW 1 126026365 missense possibly damaging 0.92
R0508:Nckap5 UTSW 1 125981384 splice site probably null
R0541:Nckap5 UTSW 1 126695722 missense possibly damaging 0.82
R0609:Nckap5 UTSW 1 126027288 nonsense probably null
R0701:Nckap5 UTSW 1 126025357 missense probably benign 0.06
R0782:Nckap5 UTSW 1 125981541 missense probably damaging 1.00
R1389:Nckap5 UTSW 1 126026710 missense probably damaging 0.99
R1401:Nckap5 UTSW 1 126014661 splice site probably benign
R1506:Nckap5 UTSW 1 126025913 nonsense probably null
R1528:Nckap5 UTSW 1 126024922 missense possibly damaging 0.68
R1942:Nckap5 UTSW 1 126024302 missense probably damaging 1.00
R1968:Nckap5 UTSW 1 126014630 missense probably damaging 0.99
R2055:Nckap5 UTSW 1 126026898 missense probably damaging 1.00
R2105:Nckap5 UTSW 1 126026518 missense probably damaging 1.00
R2214:Nckap5 UTSW 1 126025750 missense possibly damaging 0.77
R2311:Nckap5 UTSW 1 126528752 missense probably damaging 1.00
R2403:Nckap5 UTSW 1 126027409 missense probably benign 0.18
R2430:Nckap5 UTSW 1 125914757 missense probably damaging 0.99
R2914:Nckap5 UTSW 1 126026537 splice site probably null
R3782:Nckap5 UTSW 1 126025074 missense possibly damaging 0.93
R4133:Nckap5 UTSW 1 126222706 missense probably benign 0.13
R4249:Nckap5 UTSW 1 126027639 missense probably benign 0.01
R4448:Nckap5 UTSW 1 126025726 nonsense probably null
R4456:Nckap5 UTSW 1 125914735 unclassified probably benign
R4682:Nckap5 UTSW 1 126102542 critical splice donor site probably null
R4817:Nckap5 UTSW 1 126027215 missense possibly damaging 0.68
R4907:Nckap5 UTSW 1 126026152 missense possibly damaging 0.92
R4908:Nckap5 UTSW 1 126027587 missense probably damaging 1.00
R4924:Nckap5 UTSW 1 126027028 nonsense probably null
R4926:Nckap5 UTSW 1 126528641 intron probably benign
R5032:Nckap5 UTSW 1 125977049 missense possibly damaging 0.62
R5133:Nckap5 UTSW 1 126033960 missense probably benign 0.01
R5197:Nckap5 UTSW 1 126222673 missense possibly damaging 0.79
R5238:Nckap5 UTSW 1 126027724 missense probably damaging 0.96
R5257:Nckap5 UTSW 1 126024508 missense probably damaging 0.99
R5277:Nckap5 UTSW 1 126026540 nonsense probably null
R5512:Nckap5 UTSW 1 126027744 missense possibly damaging 0.63
R5700:Nckap5 UTSW 1 125976925 critical splice donor site probably null
R5789:Nckap5 UTSW 1 126027702 missense probably damaging 1.00
R6029:Nckap5 UTSW 1 126025786 missense possibly damaging 0.89
R6249:Nckap5 UTSW 1 126024930 missense probably benign
R6292:Nckap5 UTSW 1 125915015 missense probably damaging 0.99
R6521:Nckap5 UTSW 1 126382172 missense probably damaging 1.00
R6875:Nckap5 UTSW 1 126023194 missense probably benign 0.03
R7017:Nckap5 UTSW 1 126102661 missense probably damaging 1.00
R7018:Nckap5 UTSW 1 126025048 missense probably damaging 0.99
R7054:Nckap5 UTSW 1 126258712 splice site probably null
R7204:Nckap5 UTSW 1 126026367 missense probably benign
R7336:Nckap5 UTSW 1 126026049 missense probably benign 0.00
R7544:Nckap5 UTSW 1 126026211 missense possibly damaging 0.92
R7590:Nckap5 UTSW 1 126026533 missense probably benign 0.00
R7684:Nckap5 UTSW 1 126026857 missense probably benign 0.00
R7749:Nckap5 UTSW 1 126024646 missense probably damaging 1.00
R7773:Nckap5 UTSW 1 126026844 missense probably benign 0.00
R7813:Nckap5 UTSW 1 126025426 missense probably benign 0.10
R7970:Nckap5 UTSW 1 126025021 nonsense probably null
R7992:Nckap5 UTSW 1 126026810 missense probably damaging 0.99
R8278:Nckap5 UTSW 1 126027772 missense probably damaging 1.00
R8373:Nckap5 UTSW 1 126026295 missense probably benign 0.02
R8414:Nckap5 UTSW 1 126014620 missense probably damaging 1.00
Z1088:Nckap5 UTSW 1 126024832 missense possibly damaging 0.76
Z1176:Nckap5 UTSW 1 126528681 critical splice donor site probably null
Z1177:Nckap5 UTSW 1 126222659 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTGTCAAGGACTCATTCACTCCTG -3'
(R):5'- GGGTTGAAATCCCCGCTGTTGAAAG -3'

Sequencing Primer
(F):5'- GGACTCATTCACTCCTGAGAAGG -3'
(R):5'- GAAGAAACCATCTGTGGCCT -3'
Posted On2014-03-14