Incidental Mutation 'R1350:Bivm'
ID159506
Institutional Source Beutler Lab
Gene Symbol Bivm
Ensembl Gene ENSMUSG00000041684
Gene Namebasic, immunoglobulin-like variable motif containing
Synonyms
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1350 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location44118957-44144770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44126703 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 104 (N104K)
Ref Sequence ENSEMBL: ENSMUSP00000110357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035991] [ENSMUST00000114709] [ENSMUST00000129068] [ENSMUST00000155917]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035991
AA Change: N104K

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041964
Gene: ENSMUSG00000041684
AA Change: N104K

DomainStartEndE-ValueType
low complexity region 117 129 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
Blast:XPGN 456 501 3e-11 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000114709
AA Change: N104K

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110357
Gene: ENSMUSG00000041684
AA Change: N104K

DomainStartEndE-ValueType
low complexity region 117 129 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
Blast:XPGN 456 501 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138521
Predicted Effect probably benign
Transcript: ENSMUST00000155917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186280
Meta Mutation Damage Score 0.0631 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Bivm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Bivm APN 1 44129291 missense probably damaging 1.00
IGL01384:Bivm APN 1 44126747 missense possibly damaging 0.86
IGL01552:Bivm APN 1 44126773 missense probably benign 0.40
IGL01736:Bivm APN 1 44141813 missense probably damaging 1.00
IGL02332:Bivm APN 1 44128720 unclassified probably benign
IGL02704:Bivm APN 1 44126446 missense probably benign
IGL02859:Bivm APN 1 44136999 nonsense probably null
IGL02939:Bivm APN 1 44142960 missense probably benign 0.03
IGL03265:Bivm APN 1 44141845 missense probably damaging 1.00
R0456:Bivm UTSW 1 44126809 missense probably damaging 1.00
R1172:Bivm UTSW 1 44126782 missense probably benign 0.04
R1173:Bivm UTSW 1 44126782 missense probably benign 0.04
R1174:Bivm UTSW 1 44126782 missense probably benign 0.04
R1177:Bivm UTSW 1 44142963 missense probably benign 0.28
R1611:Bivm UTSW 1 44126747 missense possibly damaging 0.92
R2518:Bivm UTSW 1 44129615 missense probably damaging 0.96
R3735:Bivm UTSW 1 44126434 missense probably benign 0.07
R4290:Bivm UTSW 1 44138633 missense probably damaging 1.00
R4292:Bivm UTSW 1 44138633 missense probably damaging 1.00
R4293:Bivm UTSW 1 44138633 missense probably damaging 1.00
R4294:Bivm UTSW 1 44138633 missense probably damaging 1.00
R4849:Bivm UTSW 1 44142873 missense possibly damaging 0.70
R5204:Bivm UTSW 1 44138578 missense probably damaging 0.96
R5912:Bivm UTSW 1 44126413 nonsense probably null
R6045:Bivm UTSW 1 44119073 start gained probably benign
R6216:Bivm UTSW 1 44126868 critical splice donor site probably null
R6836:Bivm UTSW 1 44143136 missense possibly damaging 0.88
R7120:Bivm UTSW 1 44126446 missense probably benign
R7817:Bivm UTSW 1 44126401 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGTGAGCACACATCTGAGAACAAG -3'
(R):5'- CAATGATGCTGCTGGCTTAGCAAC -3'

Sequencing Primer
(F):5'- CTTTCTATACAAGTGCCTCAGAAGC -3'
(R):5'- GTTGTTACCTGTAAACTTCATAGCTC -3'
Posted On2014-03-14