Incidental Mutation 'R1350:Garnl3'
ID159508
Institutional Source Beutler Lab
Gene Symbol Garnl3
Ensembl Gene ENSMUSG00000038860
Gene NameGTPase activating RANGAP domain-like 3
Synonyms
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R1350 (G1)
Quality Score195
Status Validated
Chromosome2
Chromosomal Location32986224-33131654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33052214 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 85 (V85A)
Ref Sequence ENSEMBL: ENSMUSP00000099874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000124000] [ENSMUST00000127509] [ENSMUST00000133135] [ENSMUST00000137381]
Predicted Effect probably damaging
Transcript: ENSMUST00000049618
AA Change: V89A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860
AA Change: V89A

DomainStartEndE-ValueType
Pfam:Rap_GAP 202 383 3.4e-73 PFAM
Pfam:CNH 475 780 3.5e-67 PFAM
low complexity region 793 804 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102810
AA Change: V85A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860
AA Change: V85A

DomainStartEndE-ValueType
Pfam:Rap_GAP 198 385 4.6e-67 PFAM
Pfam:CNH 471 776 1.8e-68 PFAM
low complexity region 789 800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124000
SMART Domains Protein: ENSMUSP00000123601
Gene: ENSMUSG00000038860

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127509
Predicted Effect probably benign
Transcript: ENSMUST00000133135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135296
Predicted Effect probably damaging
Transcript: ENSMUST00000137381
AA Change: V130A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148043
Meta Mutation Damage Score 0.0908 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Garnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Garnl3 APN 2 33006816 missense probably damaging 1.00
IGL01601:Garnl3 APN 2 32997689 nonsense probably null
IGL01981:Garnl3 APN 2 32997729 missense probably damaging 0.98
IGL02209:Garnl3 APN 2 33085930 missense probably damaging 0.99
IGL02434:Garnl3 APN 2 33054205 missense probably damaging 1.00
IGL02512:Garnl3 APN 2 33031138 missense probably damaging 1.00
IGL02947:Garnl3 APN 2 33046594 missense probably damaging 1.00
PIT4403001:Garnl3 UTSW 2 32990758 missense probably damaging 1.00
R0123:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0134:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0225:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0551:Garnl3 UTSW 2 33016738 missense probably damaging 1.00
R0691:Garnl3 UTSW 2 33085907 missense probably damaging 1.00
R0693:Garnl3 UTSW 2 33085907 missense probably damaging 1.00
R0737:Garnl3 UTSW 2 32990642 missense probably damaging 0.98
R1691:Garnl3 UTSW 2 32997663 nonsense probably null
R1791:Garnl3 UTSW 2 33034127 missense probably benign 0.02
R1938:Garnl3 UTSW 2 33005200 missense probably damaging 0.99
R2100:Garnl3 UTSW 2 33046645 missense probably benign 0.35
R2316:Garnl3 UTSW 2 33005152 missense probably damaging 1.00
R2353:Garnl3 UTSW 2 33064034 missense probably damaging 1.00
R3161:Garnl3 UTSW 2 33034711 missense probably damaging 1.00
R3839:Garnl3 UTSW 2 32989546 missense probably benign 0.00
R3847:Garnl3 UTSW 2 32992228 missense probably benign
R4871:Garnl3 UTSW 2 33087088 start codon destroyed probably null 0.77
R5682:Garnl3 UTSW 2 33054173 missense probably damaging 1.00
R5811:Garnl3 UTSW 2 33006899 missense probably damaging 0.99
R6267:Garnl3 UTSW 2 33104880 missense probably benign 0.20
R6502:Garnl3 UTSW 2 33006821 missense possibly damaging 0.67
R6532:Garnl3 UTSW 2 33031119 missense possibly damaging 0.87
R6639:Garnl3 UTSW 2 32989525 missense possibly damaging 0.75
R6763:Garnl3 UTSW 2 33054196 missense probably damaging 1.00
R6866:Garnl3 UTSW 2 33002773 splice site probably null
R6913:Garnl3 UTSW 2 32986829 missense possibly damaging 0.91
R7002:Garnl3 UTSW 2 33054193 missense possibly damaging 0.65
R7168:Garnl3 UTSW 2 32995078 missense probably damaging 1.00
R7341:Garnl3 UTSW 2 33034129 missense probably damaging 1.00
R7746:Garnl3 UTSW 2 32992257 missense probably damaging 1.00
R8079:Garnl3 UTSW 2 33018499 critical splice donor site probably null
R8087:Garnl3 UTSW 2 33045536 missense probably benign 0.01
R8123:Garnl3 UTSW 2 33104938 missense probably damaging 0.97
R8170:Garnl3 UTSW 2 33015223 missense possibly damaging 0.88
X0022:Garnl3 UTSW 2 33022668 missense probably damaging 1.00
X0023:Garnl3 UTSW 2 33026149 missense probably damaging 1.00
X0024:Garnl3 UTSW 2 33005179 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGCGACATCAAACTCAAGTCAGG -3'
(R):5'- CAGCATCCAAAGAGCTGATGCAAAG -3'

Sequencing Primer
(F):5'- GGTACTTACTGTTTTCCGCCAAAG -3'
(R):5'- tctcgtccgtctcagcc -3'
Posted On2014-03-14