Incidental Mutation 'R1350:Uox'
ID159515
Institutional Source Beutler Lab
Gene Symbol Uox
Ensembl Gene ENSMUSG00000028186
Gene Nameurate oxidase
Synonyms
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R1350 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location146570426-146632305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146624575 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 162 (D162G)
Ref Sequence ENSEMBL: ENSMUSP00000143418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029837] [ENSMUST00000121133] [ENSMUST00000199489]
Predicted Effect probably damaging
Transcript: ENSMUST00000029837
AA Change: D186G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029837
Gene: ENSMUSG00000028186
AA Change: D186G

DomainStartEndE-ValueType
Pfam:Uricase 19 144 8.7e-25 PFAM
Pfam:Uricase 153 292 5.6e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121133
AA Change: D113G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113649
Gene: ENSMUSG00000028186
AA Change: D113G

DomainStartEndE-ValueType
Pfam:Uricase 2 72 1.2e-19 PFAM
Pfam:Uricase 79 181 8.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199489
AA Change: D162G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143418
Gene: ENSMUSG00000028186
AA Change: D162G

DomainStartEndE-ValueType
Pfam:Uricase 1 121 8.3e-35 PFAM
Pfam:Uricase 128 228 1.8e-19 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
MGI Phenotype PHENOTYPE: Homozygous null mutants exhibit marked hyperuricemia and urate nephropathy. Most mutants die prior to four weeks of age. Homozygotes for a large paracentric inversion disrupting this same gene exhibit a similar phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Uox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Uox APN 3 146627810 missense probably benign 0.00
IGL00902:Uox APN 3 146610406 missense possibly damaging 0.95
IGL02409:Uox APN 3 146624626 missense probably benign 0.06
IGL02827:Uox APN 3 146597196 intron probably benign
IGL02979:Uox APN 3 146610491 splice site probably null
IGL03375:Uox APN 3 146625835 missense probably damaging 1.00
kamloops UTSW 3 146624577 nonsense probably null
R1634:Uox UTSW 3 146612383 nonsense probably null
R1900:Uox UTSW 3 146610379 missense probably damaging 1.00
R2000:Uox UTSW 3 146610399 missense possibly damaging 0.65
R2119:Uox UTSW 3 146612542 missense probably benign 0.01
R5329:Uox UTSW 3 146624545 missense probably damaging 1.00
R5606:Uox UTSW 3 146610302 nonsense probably null
R6281:Uox UTSW 3 146624577 nonsense probably null
R6327:Uox UTSW 3 146624577 nonsense probably null
R6337:Uox UTSW 3 146624577 nonsense probably null
R6364:Uox UTSW 3 146624577 nonsense probably null
R6365:Uox UTSW 3 146624577 nonsense probably null
R6369:Uox UTSW 3 146624577 nonsense probably null
R6483:Uox UTSW 3 146624577 nonsense probably null
R6492:Uox UTSW 3 146624577 nonsense probably null
R6494:Uox UTSW 3 146624577 nonsense probably null
R6556:Uox UTSW 3 146624648 critical splice donor site probably null
R6803:Uox UTSW 3 146612509 missense possibly damaging 0.91
R7809:Uox UTSW 3 146627858 nonsense probably null
R7868:Uox UTSW 3 146610274 missense probably benign 0.01
R8131:Uox UTSW 3 146625834 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGATTGGTGAAGACACGGTTCTG -3'
(R):5'- TGGCAGCGTCAGTATGATGATTCTC -3'

Sequencing Primer
(F):5'- GAAGACACGGTTCTGCTTATACTC -3'
(R):5'- ccccaccactgagaacac -3'
Posted On2014-03-14