Incidental Mutation 'R1350:Skint7'
ID159517
Institutional Source Beutler Lab
Gene Symbol Skint7
Ensembl Gene ENSMUSG00000049214
Gene Nameselection and upkeep of intraepithelial T cells 7
Synonyms
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1350 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location111972923-111988223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 111980324 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 100 (A100S)
Ref Sequence ENSEMBL: ENSMUSP00000127347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055014] [ENSMUST00000106568] [ENSMUST00000163281]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055014
AA Change: A100S

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054822
Gene: ENSMUSG00000049214
AA Change: A100S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 7.82e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106568
AA Change: A100S

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102178
Gene: ENSMUSG00000049214
AA Change: A100S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 7.82e-6 SMART
transmembrane domain 250 272 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142162
Predicted Effect possibly damaging
Transcript: ENSMUST00000163281
AA Change: A100S

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127347
Gene: ENSMUSG00000049214
AA Change: A100S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 7.82e-6 SMART
transmembrane domain 250 272 N/A INTRINSIC
transmembrane domain 285 307 N/A INTRINSIC
transmembrane domain 327 349 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Skint7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Skint7 APN 4 111982205 missense probably damaging 1.00
IGL01697:Skint7 APN 4 111980457 splice site probably benign
IGL01961:Skint7 APN 4 111977463 missense probably benign 0.01
IGL02232:Skint7 APN 4 111982028 missense possibly damaging 0.70
IGL02675:Skint7 APN 4 111981981 missense probably benign 0.03
IGL02729:Skint7 APN 4 111982170 missense probably benign 0.01
IGL02887:Skint7 APN 4 111982178 missense possibly damaging 0.70
ratio UTSW 4 111984876 splice site probably null
R0315:Skint7 UTSW 4 111988118 missense possibly damaging 0.61
R0401:Skint7 UTSW 4 111980362 missense probably damaging 0.96
R0545:Skint7 UTSW 4 111980198 missense probably benign 0.08
R0607:Skint7 UTSW 4 111977459 nonsense probably null
R0685:Skint7 UTSW 4 111980345 missense possibly damaging 0.71
R1130:Skint7 UTSW 4 111984158 missense probably benign 0.23
R1340:Skint7 UTSW 4 111980219 missense probably damaging 1.00
R1764:Skint7 UTSW 4 111982073 missense probably benign 0.00
R1804:Skint7 UTSW 4 111982012 missense probably damaging 1.00
R2005:Skint7 UTSW 4 111984850 missense probably benign 0.13
R2084:Skint7 UTSW 4 111980178 missense probably damaging 0.99
R4651:Skint7 UTSW 4 111982112 missense probably damaging 1.00
R4652:Skint7 UTSW 4 111982112 missense probably damaging 1.00
R5070:Skint7 UTSW 4 111984134 missense probably damaging 1.00
R5088:Skint7 UTSW 4 111980430 missense possibly damaging 0.78
R5096:Skint7 UTSW 4 111981955 missense probably damaging 0.98
R5311:Skint7 UTSW 4 111980304 missense probably damaging 0.99
R5524:Skint7 UTSW 4 111980349 missense probably damaging 1.00
R5777:Skint7 UTSW 4 111988092 missense probably benign 0.29
R6208:Skint7 UTSW 4 111984876 splice site probably null
R6369:Skint7 UTSW 4 111980293 missense probably benign 0.16
R6752:Skint7 UTSW 4 111980266 missense probably benign 0.21
R7396:Skint7 UTSW 4 111988127 missense probably benign
R7633:Skint7 UTSW 4 111984140 missense probably benign 0.27
R7840:Skint7 UTSW 4 111982226 missense probably benign
R8054:Skint7 UTSW 4 111982229 missense probably benign
R8253:Skint7 UTSW 4 111977478 nonsense probably null
Z1176:Skint7 UTSW 4 111980129 missense probably benign 0.01
Z1177:Skint7 UTSW 4 111980235 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGAAACTGAGGGTAACTACTCCCAC -3'
(R):5'- TCCATTTATTGGGCACAAAGACACTGG -3'

Sequencing Primer
(F):5'- TACTCCCACAAGACACCTGTTAG -3'
(R):5'- GTATACTGTGCTCCACAAACAAC -3'
Posted On2014-03-14