Incidental Mutation 'R1350:Fam213b'
ID159520
Institutional Source Beutler Lab
Gene Symbol Fam213b
Ensembl Gene ENSMUSG00000029059
Gene Namefamily with sequence similarity 213, member B
SynonymsPM/PGFS, 2810405K02Rik
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1350 (G1)
Quality Score221
Status Validated
Chromosome4
Chromosomal Location154895504-154899135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 154898128 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 107 (R107L)
Ref Sequence ENSEMBL: ENSMUSP00000030935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030935] [ENSMUST00000079269] [ENSMUST00000080559] [ENSMUST00000105634] [ENSMUST00000105635] [ENSMUST00000132281] [ENSMUST00000163732]
Predicted Effect probably damaging
Transcript: ENSMUST00000030935
AA Change: R107L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030935
Gene: ENSMUSG00000029059
AA Change: R107L

DomainStartEndE-ValueType
Pfam:AhpC-TSA_2 53 166 9.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079269
SMART Domains Protein: ENSMUSP00000078252
Gene: ENSMUSG00000058183

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 99 498 1.7e-135 PFAM
Pfam:Peptidase_M13 559 767 1.2e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080559
SMART Domains Protein: ENSMUSP00000079399
Gene: ENSMUSG00000058183

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 512 4.8e-131 PFAM
Pfam:Peptidase_M13 573 779 3.4e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105634
SMART Domains Protein: ENSMUSP00000101259
Gene: ENSMUSG00000058183

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 512 1.4e-105 PFAM
Pfam:Peptidase_M13 573 781 4e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105635
SMART Domains Protein: ENSMUSP00000101260
Gene: ENSMUSG00000058183

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 475 1.6e-135 PFAM
Pfam:Peptidase_M13 536 744 1.2e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129623
Predicted Effect probably damaging
Transcript: ENSMUST00000132281
AA Change: R63L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116611
Gene: ENSMUSG00000029059
AA Change: R63L

DomainStartEndE-ValueType
Pfam:AhpC-TSA_2 9 114 4.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163732
SMART Domains Protein: ENSMUSP00000131753
Gene: ENSMUSG00000058183

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 99 498 1.7e-135 PFAM
Pfam:Peptidase_M13 559 765 3.3e-71 PFAM
Meta Mutation Damage Score 0.7644 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Fam213b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Fam213b APN 4 154896602 unclassified probably benign
IGL03102:Fam213b APN 4 154896601 unclassified probably benign
R1676:Fam213b UTSW 4 154897063 missense probably benign 0.05
R1778:Fam213b UTSW 4 154897357 missense probably damaging 0.98
R2164:Fam213b UTSW 4 154898149 missense probably damaging 1.00
R4468:Fam213b UTSW 4 154897050 missense probably benign 0.01
R5007:Fam213b UTSW 4 154897074 unclassified probably null
R5386:Fam213b UTSW 4 154899005 start codon destroyed probably benign 0.01
R6820:Fam213b UTSW 4 154898166 missense probably damaging 1.00
R7437:Fam213b UTSW 4 154896596 missense possibly damaging 0.53
X0063:Fam213b UTSW 4 154898953 missense probably benign 0.03
Z1176:Fam213b UTSW 4 154898989 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACAGGCAGTCTGTGGCAAC -3'
(R):5'- AGACCTAGTGGCAAAGTCCCAGTG -3'

Sequencing Primer
(F):5'- AGGTCCCTCCTGTTTATGAAATAGC -3'
(R):5'- GCAAAGTCCCAGTGACTCTTG -3'
Posted On2014-03-14