Incidental Mutation 'R1350:Ssu2'
ID159527
Institutional Source Beutler Lab
Gene Symbol Ssu2
Ensembl Gene ENSMUSG00000034387
Gene Namessu-2 homolog (C. elegans)
SynonymsD630042P16Rik
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1350 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location112359324-112388023 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 112374846 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 306 (L306*)
Ref Sequence ENSEMBL: ENSMUSP00000052328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060847]
Predicted Effect probably null
Transcript: ENSMUST00000060847
AA Change: L306*
SMART Domains Protein: ENSMUSP00000052328
Gene: ENSMUSG00000034387
AA Change: L306*

DomainStartEndE-ValueType
internal_repeat_1 177 194 6.13e-5 PROSPERO
internal_repeat_1 188 205 6.13e-5 PROSPERO
low complexity region 214 234 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143134
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
MGI Phenotype PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele exhibit abnormal tooth morphology, narrowed pulp cavity, increased dentin thickness, abnormal tooth attrition and collagenous attachment to the gum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Ssu2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Ssu2 APN 6 112374882 missense probably damaging 1.00
IGL01752:Ssu2 APN 6 112375592 missense probably damaging 1.00
IGL02820:Ssu2 APN 6 112382392 missense probably benign 0.13
R0047:Ssu2 UTSW 6 112374820 missense probably damaging 1.00
R0047:Ssu2 UTSW 6 112374820 missense probably damaging 1.00
R0551:Ssu2 UTSW 6 112380554 missense possibly damaging 0.86
R0931:Ssu2 UTSW 6 112384398 missense probably damaging 1.00
R1512:Ssu2 UTSW 6 112387998 start codon destroyed probably null 0.91
R1908:Ssu2 UTSW 6 112384427 missense probably benign 0.00
R2013:Ssu2 UTSW 6 112383941 missense possibly damaging 0.85
R2915:Ssu2 UTSW 6 112377605 nonsense probably null
R4526:Ssu2 UTSW 6 112382422 missense possibly damaging 0.73
R4782:Ssu2 UTSW 6 112376450 missense probably damaging 1.00
R5099:Ssu2 UTSW 6 112359624 missense probably benign 0.34
R5396:Ssu2 UTSW 6 112380996 missense probably damaging 0.99
R6223:Ssu2 UTSW 6 112376448 nonsense probably null
R6241:Ssu2 UTSW 6 112374820 missense probably damaging 1.00
R6476:Ssu2 UTSW 6 112374832 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCCTTCAAGCCTCAAATGC -3'
(R):5'- TTTTGTCCCGGACTCTGAGCCAAC -3'

Sequencing Primer
(F):5'- AATGCTGGCCCTCAACTC -3'
(R):5'- TCTGAAGAGGTTTCCTCAGC -3'
Posted On2014-03-14