Incidental Mutation 'R1350:Usp18'
ID159528
Institutional Source Beutler Lab
Gene Symbol Usp18
Ensembl Gene ENSMUSG00000030107
Gene Nameubiquitin specific peptidase 18
Synonyms1110058H21Rik, UBP43
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R1350 (G1)
Quality Score191
Status Validated
Chromosome6
Chromosomal Location121245906-121270917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121262692 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 249 (T249A)
Ref Sequence ENSEMBL: ENSMUSP00000032198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032198
AA Change: T249A

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032198
Gene: ENSMUSG00000030107
AA Change: T249A

DomainStartEndE-ValueType
Pfam:UCH 51 363 3.1e-41 PFAM
Pfam:UCH_1 52 335 6.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204926
Meta Mutation Damage Score 0.2600 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ubiquitin-specific proteases (UBP) family of enzymes that cleave ubiquitin from ubiquitinated protein substrates. It is highly expressed in liver and thymus, and is localized to the nucleus. This protein efficiently cleaves only ISG15 (a ubiquitin-like protein) fusions, and deletion of this gene in mice results in a massive increase of ISG15 conjugates in tissues, indicating that this protein is a major ISG15-specific protease. Mice lacking this gene are also hypersensitive to interferon, suggesting a function of this protein in downregulating interferon responses, independent of its isopeptidase activity towards ISG15. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mutants die prematurely with cellular necrosis in the ependyma, breakdown of blood-brain barrier, hydrocephaly with enlarged ventricles, and severe neurological abnormalities. Mice homozygous for an ENU-induced allele exhibit increased susceptibility to Salmonella infection and LPS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Usp18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Usp18 APN 6 121255382 nonsense probably null
IGL01403:Usp18 APN 6 121268668 missense possibly damaging 0.67
IGL01411:Usp18 APN 6 121261421 missense probably benign 0.01
IGL01810:Usp18 APN 6 121253771 missense probably damaging 1.00
IGL02568:Usp18 APN 6 121261091 missense probably benign 0.00
IGL02613:Usp18 APN 6 121261090 missense probably benign 0.11
R0961:Usp18 UTSW 6 121261493 missense probably benign 0.00
R1855:Usp18 UTSW 6 121262117 missense probably benign 0.07
R1916:Usp18 UTSW 6 121268554 missense probably benign 0.14
R1981:Usp18 UTSW 6 121252517 missense probably benign 0.08
R2015:Usp18 UTSW 6 121268550 missense probably damaging 1.00
R4062:Usp18 UTSW 6 121261367 missense probably benign
R5000:Usp18 UTSW 6 121252520 missense possibly damaging 0.84
R5894:Usp18 UTSW 6 121261497 missense probably benign 0.03
R6006:Usp18 UTSW 6 121262822 missense possibly damaging 0.58
R6932:Usp18 UTSW 6 121252514 missense probably benign 0.01
R7357:Usp18 UTSW 6 121253849 missense possibly damaging 0.90
R8243:Usp18 UTSW 6 121269144 missense probably benign 0.00
Z1177:Usp18 UTSW 6 121255275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTTGAAGGTGCTCTGCTGCTC -3'
(R):5'- CACGATGCTGGTCCATATCACCTC -3'

Sequencing Primer
(F):5'- GCTCTGCTGCTCCCGTG -3'
(R):5'- AGTTACAGAGCAAGTCTTTGGC -3'
Posted On2014-03-14