Incidental Mutation 'R1350:Olfr64'
ID159530
Institutional Source Beutler Lab
Gene Symbol Olfr64
Ensembl Gene ENSMUSG00000063615
Gene Nameolfactory receptor 64
SynonymsGA_x6K02T2PBJ9-6648196-6649143, 5'[b]2, MOR1-2
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R1350 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103889485-103894485 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103893730 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 2 (W2R)
Ref Sequence ENSEMBL: ENSMUSP00000080444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081748]
Predicted Effect probably benign
Transcript: ENSMUST00000081748
AA Change: W2R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000080444
Gene: ENSMUSG00000063615
AA Change: W2R

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.4e-113 PFAM
Pfam:7TM_GPCR_Srsx 33 295 4.2e-6 PFAM
Pfam:7tm_1 39 290 1.1e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Olfr64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Olfr64 APN 7 103892864 nonsense probably null
IGL01597:Olfr64 APN 7 103893096 missense probably benign 0.01
IGL01868:Olfr64 APN 7 103893376 nonsense probably null
IGL02502:Olfr64 APN 7 103893489 missense probably damaging 0.99
R0294:Olfr64 UTSW 7 103892930 missense probably benign 0.09
R0534:Olfr64 UTSW 7 103893231 missense probably benign 0.00
R0838:Olfr64 UTSW 7 103893415 missense probably benign 0.00
R1733:Olfr64 UTSW 7 103892911 missense probably benign 0.40
R1768:Olfr64 UTSW 7 103893277 missense probably benign 0.28
R1780:Olfr64 UTSW 7 103893555 missense probably damaging 1.00
R1836:Olfr64 UTSW 7 103893385 missense probably damaging 0.98
R1956:Olfr64 UTSW 7 103893718 missense probably benign 0.01
R2075:Olfr64 UTSW 7 103892920 missense probably damaging 0.96
R4677:Olfr64 UTSW 7 103893408 missense probably damaging 1.00
R4884:Olfr64 UTSW 7 103893655 missense probably benign 0.04
R4899:Olfr64 UTSW 7 103893465 missense possibly damaging 0.54
R5753:Olfr64 UTSW 7 103893201 missense probably damaging 1.00
R6351:Olfr64 UTSW 7 103893135 nonsense probably null
R6997:Olfr64 UTSW 7 103893031 missense probably benign 0.00
R8319:Olfr64 UTSW 7 103893429 missense probably damaging 1.00
X0017:Olfr64 UTSW 7 103893151 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGTAACTGTGAGGTCTGTGCCC -3'
(R):5'- GCAAGCATTATCAAGGCAGATGTGG -3'

Sequencing Primer
(F):5'- CATGGCAAGGAAATAGTACATGG -3'
(R):5'- GAATACTTGTTGCATCATCTGGC -3'
Posted On2014-03-14