Incidental Mutation 'R1350:Olfr46'
ID159531
Institutional Source Beutler Lab
Gene Symbol Olfr46
Ensembl Gene ENSMUSG00000093942
Gene Nameolfactory receptor 46
SynonymsID12, IF5, MOR253-8, GA_x6K02T2PBJ9-42759973-42760905, IB7
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R1350 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140601269-140617678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140610709 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 181 (V181A)
Ref Sequence ENSEMBL: ENSMUSP00000072445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072655] [ENSMUST00000211771] [ENSMUST00000214180]
Predicted Effect probably damaging
Transcript: ENSMUST00000072655
AA Change: V181A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072445
Gene: ENSMUSG00000093942
AA Change: V181A

DomainStartEndE-ValueType
Pfam:7tm_4 39 315 1.1e-50 PFAM
Pfam:7TM_GPCR_Srsx 43 209 5.9e-8 PFAM
Pfam:7tm_1 49 298 3.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211771
AA Change: V173A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000214180
AA Change: V173A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Olfr46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Olfr46 APN 7 140610753 missense probably damaging 1.00
IGL02408:Olfr46 APN 7 140610931 missense probably damaging 1.00
IGL02496:Olfr46 APN 7 140610168 start codon destroyed probably benign
IGL03003:Olfr46 APN 7 140610370 missense probably damaging 1.00
R0538:Olfr46 UTSW 7 140610384 missense probably damaging 1.00
R1466:Olfr46 UTSW 7 140610969 missense probably benign 0.01
R1466:Olfr46 UTSW 7 140610969 missense probably benign 0.01
R2008:Olfr46 UTSW 7 140610585 missense probably damaging 1.00
R4110:Olfr46 UTSW 7 140610264 missense probably benign 0.20
R4110:Olfr46 UTSW 7 140610265 missense possibly damaging 0.89
R4255:Olfr46 UTSW 7 140610587 nonsense probably null
R4622:Olfr46 UTSW 7 140610698 nonsense probably null
R4809:Olfr46 UTSW 7 140611074 missense probably damaging 0.98
R4826:Olfr46 UTSW 7 140610319 missense probably benign 0.02
R4989:Olfr46 UTSW 7 140610391 missense possibly damaging 0.95
R5177:Olfr46 UTSW 7 140610189 missense probably benign 0.00
R5261:Olfr46 UTSW 7 140610663 missense probably benign 0.00
R5770:Olfr46 UTSW 7 140610943 missense probably damaging 1.00
R5863:Olfr46 UTSW 7 140610631 missense probably damaging 0.97
R6082:Olfr46 UTSW 7 140610681 missense probably benign 0.00
R6705:Olfr46 UTSW 7 140610784 missense probably damaging 0.99
R7216:Olfr46 UTSW 7 140610460 missense possibly damaging 0.87
R7443:Olfr46 UTSW 7 140611048 missense probably damaging 1.00
R7485:Olfr46 UTSW 7 140610178 missense probably benign 0.02
R7806:Olfr46 UTSW 7 140610772 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCAACCAGACAGTAGTGACAGAG -3'
(R):5'- TGGCAATGATGCAGCCATAGGATAG -3'

Sequencing Primer
(F):5'- TCCTTCAAAGGGTGCATGAC -3'
(R):5'- TGCAGCCATAGGATAGCAAGG -3'
Posted On2014-03-14