Mutagenetix > Incidental Mutations

Incidental Mutation 'R1350:Olfr46'

159531

Institutional Source

Beutler Lab

Gene Symbol

Olfr46

Ensembl Gene

ENSMUSG00000093942

Gene Name

olfactory receptor 46

Synonyms

ID12, IF5, MOR253-8, GA_x6K02T2PBJ9-42759973-42760905, IB7

MMRRC Submission

039415-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R1350 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

140601269-140617678 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 140610709 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 181 (V181A)

Ref Sequence

ENSEMBL: ENSMUSP00000072445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072655] [ENSMUST00000211771] [ENSMUST00000214180]

AlphaFold

Q8VGJ4

Predicted Effect

probably damaging
Transcript: ENSMUST00000072655
AA Change: V181A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000072445
Gene: ENSMUSG00000093942
AA Change: V181A

Domain	Start	End	E-Value	Type
Pfam:7tm_4	39	315	1.1e-50	PFAM
Pfam:7TM_GPCR_Srsx	43	209	5.9e-8	PFAM
Pfam:7tm_1	49	298	3.4e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211771
AA Change: V173A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Predicted Effect

probably benign
Transcript: ENSMUST00000214180
AA Change: V173A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 94.9%
20x: 88.1%

Validation Efficiency

95% (57/60)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago4	A	G	4: 126,507,132	V640A	probably benign	Het
AI661453	C	T	17: 47,467,928	Q860*	probably null	Het
Atp10d	A	G	5: 72,261,126		probably benign	Het
Axdnd1	A	G	1: 156,378,380		probably null	Het
Bivm	T	A	1: 44,126,703	N104K	possibly damaging	Het
Capn15	A	G	17: 25,964,692	S338P	probably benign	Het
Car9	G	T	4: 43,512,439		probably null	Het
Col13a1	G	A	10: 61,894,069		probably benign	Het
Crb2	A	G	2: 37,792,069	N821D	probably damaging	Het
D5Ertd579e	T	A	5: 36,613,737	I1105F	probably damaging	Het
Dnaja2	A	T	8: 85,540,088	F337I	probably damaging	Het
Dntt	C	T	19: 41,037,139		probably benign	Het
Dock3	C	T	9: 106,914,632	E1381K	possibly damaging	Het
Fam213b	C	A	4: 154,898,128	R107L	probably damaging	Het
Fibp	T	C	19: 5,461,391	Y96H	probably damaging	Het
Garnl3	A	G	2: 33,052,214	V85A	probably damaging	Het
Gsdme	A	T	6: 50,246,128		probably null	Het
Gucy2c	A	T	6: 136,743,914		probably null	Het
Hectd1	A	G	12: 51,762,434	V1748A	probably benign	Het
Hepacam2	G	A	6: 3,467,530	Q384*	probably null	Het
Itga10	T	A	3: 96,657,477	M961K	probably benign	Het
Kcnk1	C	T	8: 126,025,228	T191I	probably benign	Het
Khdrbs1	G	A	4: 129,720,752	P336L	probably benign	Het
Klhdc2	T	A	12: 69,305,710		probably null	Het
Lipc	T	C	9: 70,798,367	H478R	probably benign	Het
Lrp12	A	T	15: 39,878,250	C356*	probably null	Het
Nf1	T	A	11: 79,412,687	C397S	probably damaging	Het
Nox3	A	G	17: 3,650,121	F439S	probably damaging	Het
Olfr1121	T	A	2: 87,372,357	V275E	probably benign	Het
Olfr1271	A	T	2: 90,266,346	L28Q	probably damaging	Het
Olfr401	T	C	11: 74,122,213	L308P	possibly damaging	Het
Olfr64	A	G	7: 103,893,730	W2R	probably benign	Het
Olfr847	T	G	9: 19,375,414	S156R	possibly damaging	Het
Olfr884	G	A	9: 38,047,815	V198I	probably benign	Het
Pcif1	T	C	2: 164,886,767	F288L	probably damaging	Het
Skint7	G	T	4: 111,980,324	A100S	possibly damaging	Het
Ssu2	A	T	6: 112,374,846	L306*	probably null	Het
Tasp1	T	C	2: 140,057,421	E4G	probably damaging	Het
Tfb1m	A	T	17: 3,545,680	D99E	probably benign	Het
Ube3b	A	G	5: 114,406,137		probably null	Het
Uox	A	G	3: 146,624,575	D162G	probably damaging	Het
Usp18	A	G	6: 121,262,692	T249A	possibly damaging	Het
Vmn1r202	T	C	13: 22,501,716	N177S	probably benign	Het
Vwa2	T	A	19: 56,909,126	M621K	probably damaging	Het
Wdfy3	C	A	5: 101,898,552	D1797Y	probably damaging	Het
Wisp3	C	T	10: 39,158,306	C100Y	probably damaging	Het
Ylpm1	A	T	12: 85,014,082		probably benign	Het
Zbtb9	G	A	17: 26,974,406	V262I	probably benign	Het

Other mutations in Olfr46

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Olfr46	APN	7	140610753	missense	probably damaging	1.00
IGL02408:Olfr46	APN	7	140610931	missense	probably damaging	1.00
IGL02496:Olfr46	APN	7	140610168	start codon destroyed	probably benign
IGL03003:Olfr46	APN	7	140610370	missense	probably damaging	1.00
R0538:Olfr46	UTSW	7	140610384	missense	probably damaging	1.00
R1466:Olfr46	UTSW	7	140610969	missense	probably benign	0.01
R1466:Olfr46	UTSW	7	140610969	missense	probably benign	0.01
R2008:Olfr46	UTSW	7	140610585	missense	probably damaging	1.00
R4110:Olfr46	UTSW	7	140610264	missense	probably benign	0.20
R4110:Olfr46	UTSW	7	140610265	missense	possibly damaging	0.89
R4255:Olfr46	UTSW	7	140610587	nonsense	probably null
R4622:Olfr46	UTSW	7	140610698	nonsense	probably null
R4809:Olfr46	UTSW	7	140611074	missense	probably damaging	0.98
R4826:Olfr46	UTSW	7	140610319	missense	probably benign	0.02
R4989:Olfr46	UTSW	7	140610391	missense	possibly damaging	0.95
R5177:Olfr46	UTSW	7	140610189	missense	probably benign	0.00
R5261:Olfr46	UTSW	7	140610663	missense	probably benign	0.00
R5770:Olfr46	UTSW	7	140610943	missense	probably damaging	1.00
R5863:Olfr46	UTSW	7	140610631	missense	probably damaging	0.97
R6082:Olfr46	UTSW	7	140610681	missense	probably benign	0.00
R6705:Olfr46	UTSW	7	140610784	missense	probably damaging	0.99
R7216:Olfr46	UTSW	7	140610460	missense	possibly damaging	0.87
R7443:Olfr46	UTSW	7	140611048	missense	probably damaging	1.00
R7485:Olfr46	UTSW	7	140610178	missense	probably benign	0.02
R7806:Olfr46	UTSW	7	140610772	missense	probably benign	0.00
R8373:Olfr46	UTSW	7	140610295	missense	possibly damaging	0.88
R8884:Olfr46	UTSW	7	140610703	missense	probably damaging	1.00
R9278:Olfr46	UTSW	7	140611023	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCAACCAGACAGTAGTGACAGAG -3'
(R):5'- TGGCAATGATGCAGCCATAGGATAG -3'

Sequencing Primer
(F):5'- TCCTTCAAAGGGTGCATGAC -3'
(R):5'- TGCAGCCATAGGATAGCAAGG -3'

Posted On

2014-03-14