Incidental Mutation 'R1350:Dnaja2'
ID159532
Institutional Source Beutler Lab
Gene Symbol Dnaja2
Ensembl Gene ENSMUSG00000031701
Gene NameDnaJ heat shock protein family (Hsp40) member A2
Synonyms2010206B19Rik, mDj3, HIRIP4, 1500017M13Rik, PRO3015, DNJ3
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock #R1350 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85537633-85555344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85540088 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 337 (F337I)
Ref Sequence ENSEMBL: ENSMUSP00000034138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034138]
Predicted Effect probably damaging
Transcript: ENSMUST00000034138
AA Change: F337I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034138
Gene: ENSMUSG00000031701
AA Change: F337I

DomainStartEndE-ValueType
DnaJ 7 62 8.53e-31 SMART
low complexity region 70 83 N/A INTRINSIC
low complexity region 101 113 N/A INTRINSIC
Pfam:DnaJ_C 116 338 8.5e-36 PFAM
Pfam:DnaJ_CXXCXGXG 143 209 3.4e-18 PFAM
low complexity region 393 403 N/A INTRINSIC
Meta Mutation Damage Score 0.2596 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus; a glycine/phenylalanine (G/F)-rich region; and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain. The product of this gene works as a cochaperone of Hsp70s in protein folding and mitochondrial protein import in vitro. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Dnaja2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Dnaja2 APN 8 85555237 missense probably damaging 0.98
IGL01479:Dnaja2 APN 8 85553951 missense probably damaging 1.00
IGL01722:Dnaja2 APN 8 85553279 missense probably benign 0.35
IGL01946:Dnaja2 APN 8 85546700 missense probably damaging 1.00
IGL03310:Dnaja2 APN 8 85548905 missense probably benign 0.00
R0689:Dnaja2 UTSW 8 85546718 splice site probably benign
R2332:Dnaja2 UTSW 8 85540136 missense probably damaging 1.00
R3105:Dnaja2 UTSW 8 85555228 missense probably damaging 1.00
R3693:Dnaja2 UTSW 8 85546620 missense probably damaging 0.99
R3787:Dnaja2 UTSW 8 85540386 missense probably damaging 1.00
R4803:Dnaja2 UTSW 8 85553400 missense probably damaging 1.00
R5109:Dnaja2 UTSW 8 85553258 missense possibly damaging 0.51
R5428:Dnaja2 UTSW 8 85540175 missense probably benign
R5576:Dnaja2 UTSW 8 85539404 missense possibly damaging 0.95
R7055:Dnaja2 UTSW 8 85548674 missense probably benign 0.00
R7385:Dnaja2 UTSW 8 85539353 missense probably benign
R7662:Dnaja2 UTSW 8 85539276 missense probably benign 0.17
R7693:Dnaja2 UTSW 8 85540310 missense probably damaging 1.00
R8049:Dnaja2 UTSW 8 85539247 missense possibly damaging 0.63
Z1177:Dnaja2 UTSW 8 85540071 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTCTCCAGAGAGTTCAAAGACTTCC -3'
(R):5'- CTCGTCAGATTGTGGTGAAATACCCC -3'

Sequencing Primer
(F):5'- tcccagcaatcaaaaaacagatag -3'
(R):5'- TGGTGAAATACCCCCCTGG -3'
Posted On2014-03-14