Incidental Mutation 'R1350:Lipc'
ID159536
Institutional Source Beutler Lab
Gene Symbol Lipc
Ensembl Gene ENSMUSG00000032207
Gene Namelipase, hepatic
SynonymsHpl, HL
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R1350 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location70798128-70952226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70798367 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 478 (H478R)
Ref Sequence ENSEMBL: ENSMUSP00000034731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034731] [ENSMUST00000216798]
Predicted Effect probably benign
Transcript: ENSMUST00000034731
AA Change: H478R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034731
Gene: ENSMUSG00000032207
AA Change: H478R

DomainStartEndE-ValueType
Pfam:Lipase 14 350 1.1e-136 PFAM
LH2 353 488 4.62e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157119
Predicted Effect probably benign
Transcript: ENSMUST00000216798
AA Change: H393R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LIPC encodes hepatic triglyceride lipase, which is expressed in liver. LIPC has the dual functions of triglyceride hydrolase and ligand/bridging factor for receptor-mediated lipoprotein uptake. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit elevated plasma total cholesterol, phospholipids, and high density lipoprotein cholesterol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Lipc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Lipc APN 9 70820437 missense possibly damaging 0.56
IGL02431:Lipc APN 9 70934468 intron probably benign
Immunobolic UTSW 9 70823386 missense probably damaging 1.00
R0112:Lipc UTSW 9 70820427 missense probably damaging 1.00
R0114:Lipc UTSW 9 70803781 missense probably damaging 0.99
R0545:Lipc UTSW 9 70812705 missense probably damaging 1.00
R1051:Lipc UTSW 9 70802116 missense probably benign 0.00
R1069:Lipc UTSW 9 70823537 missense probably benign 0.03
R1742:Lipc UTSW 9 70820529 missense probably damaging 1.00
R2145:Lipc UTSW 9 70934535 missense possibly damaging 0.94
R3880:Lipc UTSW 9 70820518 missense probably damaging 0.99
R4360:Lipc UTSW 9 70852582 intron probably benign
R4999:Lipc UTSW 9 70816731 missense probably benign 0.00
R5159:Lipc UTSW 9 70812910 missense probably benign 0.03
R5197:Lipc UTSW 9 70798391 missense probably benign 0.11
R5458:Lipc UTSW 9 70852582 intron probably benign
R5710:Lipc UTSW 9 70812697 missense probably benign 0.30
R6645:Lipc UTSW 9 70803748 missense probably damaging 1.00
R6749:Lipc UTSW 9 70823386 missense probably damaging 1.00
R6849:Lipc UTSW 9 70818847 critical splice donor site probably null
R7011:Lipc UTSW 9 70818954 missense probably benign 0.09
R7346:Lipc UTSW 9 70812747 missense probably damaging 1.00
R7426:Lipc UTSW 9 70802168 missense probably benign 0.21
R7587:Lipc UTSW 9 70818924 missense probably damaging 1.00
R7830:Lipc UTSW 9 70812901 missense probably damaging 1.00
R8269:Lipc UTSW 9 70820373 missense probably damaging 1.00
X0054:Lipc UTSW 9 70812748 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGGTCCCAGGGATAGAAGAAGC -3'
(R):5'- GCCGTCAAGTCTGAAGAGCTGTAAC -3'

Sequencing Primer
(F):5'- GAAAGCATCTTTACCTGCTGAGTC -3'
(R):5'- GACGGCTTTCACTGACTCAAG -3'
Posted On2014-03-14