Incidental Mutation 'R1350:Wisp3'
ID159538
Institutional Source Beutler Lab
Gene Symbol Wisp3
Ensembl Gene ENSMUSG00000062074
Gene NameWNT1 inducible signaling pathway protein 3
SynonymsLOC327743, CCN6
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1350 (G1)
Quality Score178
Status Validated
Chromosome10
Chromosomal Location39150970-39163794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39158306 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 100 (C100Y)
Ref Sequence ENSEMBL: ENSMUSP00000076003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076713]
Predicted Effect probably damaging
Transcript: ENSMUST00000076713
AA Change: C100Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076003
Gene: ENSMUSG00000062074
AA Change: C100Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IB 46 116 1.01e-15 SMART
Blast:VWC 122 179 1e-27 BLAST
TSP1 211 253 6.58e-5 SMART
CT 273 342 1.23e-10 SMART
Meta Mutation Damage Score 0.9125 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene is overexpressed in colon tumors. It may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Mutations of this gene are associated with progressive pseudorheumatoid dysplasia, an autosomal recessive skeletal disorder, indicating that the gene is essential for normal postnatal skeletal growth and cartilage homeostasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with no obvious abnormalities in size, weight, skeletal development, ossification, or the occurrence of joint disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Wisp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Wisp3 APN 10 39158310 missense probably damaging 1.00
IGL02429:Wisp3 APN 10 39154993 missense probably benign 0.03
IGL02675:Wisp3 APN 10 39151240 missense possibly damaging 0.77
IGL03160:Wisp3 APN 10 39153237 missense probably damaging 1.00
IGL03214:Wisp3 APN 10 39153167 missense probably benign 0.04
R0666:Wisp3 UTSW 10 39151289 missense probably benign 0.45
R1478:Wisp3 UTSW 10 39153243 missense probably damaging 1.00
R1479:Wisp3 UTSW 10 39153243 missense probably damaging 1.00
R1624:Wisp3 UTSW 10 39153243 missense probably damaging 1.00
R3833:Wisp3 UTSW 10 39154949 missense probably benign 0.00
R3975:Wisp3 UTSW 10 39155098 missense probably damaging 1.00
R5051:Wisp3 UTSW 10 39155156 missense probably benign 0.00
R6000:Wisp3 UTSW 10 39158300 missense probably damaging 1.00
R6492:Wisp3 UTSW 10 39154987 missense probably benign 0.01
R6775:Wisp3 UTSW 10 39151355 missense probably damaging 0.99
R7053:Wisp3 UTSW 10 39158301 missense probably damaging 1.00
R7138:Wisp3 UTSW 10 39158477 missense possibly damaging 0.80
R7253:Wisp3 UTSW 10 39155035 missense probably benign 0.04
R7367:Wisp3 UTSW 10 39158265 missense probably damaging 1.00
R7475:Wisp3 UTSW 10 39158300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAACTGAGCCATCCCACAGGTATG -3'
(R):5'- TCACCAAACGAAGCTCTGCTGC -3'

Sequencing Primer
(F):5'- ATCCCACAGGTATGCAAAATTG -3'
(R):5'- CAGCATTGGAGGTGTATCAGC -3'
Posted On2014-03-14