Incidental Mutation 'R1350:Olfr401'
ID159539
Institutional Source Beutler Lab
Gene Symbol Olfr401
Ensembl Gene ENSMUSG00000070380
Gene Nameolfactory receptor 401
SynonymsMOR255-6, GA_x6K02T2P1NL-4278037-4278984
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1350 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74113712-74122941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74122213 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 308 (L308P)
Ref Sequence ENSEMBL: ENSMUSP00000149542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079827] [ENSMUST00000213754]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079827
AA Change: L308P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078756
Gene: ENSMUSG00000070380
AA Change: L308P

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 9.4e-51 PFAM
Pfam:7tm_1 44 293 2.2e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213754
AA Change: L308P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.3828 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Olfr401
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Olfr401 APN 11 74121879 missense probably benign 0.00
IGL01303:Olfr401 APN 11 74121334 missense probably damaging 1.00
IGL01397:Olfr401 APN 11 74121764 missense probably damaging 0.97
IGL02101:Olfr401 APN 11 74121745 nonsense probably null
IGL02121:Olfr401 APN 11 74121287 splice site probably benign
IGL02347:Olfr401 APN 11 74121571 missense probably benign 0.03
IGL03113:Olfr401 APN 11 74121703 missense probably benign 0.13
IGL03126:Olfr401 APN 11 74121784 missense probably benign 0.01
IGL03302:Olfr401 APN 11 74121633 missense possibly damaging 0.60
R0549:Olfr401 UTSW 11 74121475 missense probably damaging 1.00
R1180:Olfr401 UTSW 11 74121580 missense probably benign 0.28
R1800:Olfr401 UTSW 11 74121408 missense probably benign 0.00
R1808:Olfr401 UTSW 11 74121431 missense probably damaging 0.96
R1962:Olfr401 UTSW 11 74121824 missense probably benign 0.02
R1998:Olfr401 UTSW 11 74121580 missense probably benign 0.28
R1999:Olfr401 UTSW 11 74121580 missense probably benign 0.28
R2000:Olfr401 UTSW 11 74121580 missense probably benign 0.28
R2859:Olfr401 UTSW 11 74121982 missense probably damaging 1.00
R4914:Olfr401 UTSW 11 74121879 missense probably benign 0.00
R4915:Olfr401 UTSW 11 74121879 missense probably benign 0.00
R4916:Olfr401 UTSW 11 74121879 missense probably benign 0.00
R4918:Olfr401 UTSW 11 74121879 missense probably benign 0.00
R5292:Olfr401 UTSW 11 74122051 missense probably damaging 0.99
R5522:Olfr401 UTSW 11 74121658 missense probably damaging 1.00
R5761:Olfr401 UTSW 11 74121509 missense probably damaging 0.97
R6318:Olfr401 UTSW 11 74121721 missense possibly damaging 0.82
R6608:Olfr401 UTSW 11 74121628 missense probably benign 0.00
R6737:Olfr401 UTSW 11 74121906 missense probably benign
R6790:Olfr401 UTSW 11 74121601 missense probably damaging 1.00
R7243:Olfr401 UTSW 11 74121733 missense probably damaging 0.97
R7423:Olfr401 UTSW 11 74121985 missense probably benign 0.01
R7517:Olfr401 UTSW 11 74121509 missense probably damaging 0.97
R7833:Olfr401 UTSW 11 74121837 missense probably damaging 1.00
R8241:Olfr401 UTSW 11 74122209 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTGTGGCGACATCCACACTTC -3'
(R):5'- TCTGAGATACTCTGGGAACTCCAGC -3'

Sequencing Primer
(F):5'- GTGGTCCCAATGTGATTGACAAC -3'
(R):5'- CTCTGGGAACTCCAGCTAAAGG -3'
Posted On2014-03-14