Mutagenetix > Incidental Mutation

Incidental Mutation 'R1350:Nf1'

159540

Institutional Source

Beutler Lab

Gene Symbol

Nf1

Ensembl Gene

ENSMUSG00000020716

Gene Name

neurofibromin 1

Synonyms

Nf-1, neurofibromin

MMRRC Submission

039415-MU

Accession Numbers

Genbank: NM_010897; MGI: 97306

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1350 (G1)

Quality Score

207

Status

Validated

Chromosome

Chromosomal Location

79339693-79581612 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79412687 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 397 (C397S)

Ref Sequence

ENSEMBL: ENSMUSP00000151975 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000219057]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000071325
AA Change: C397S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: C397S

Domain	Start	End	E-Value	Type
RasGAP	1189	1559	2.56e-151	SMART
SEC14	1585	1737	2.36e-11	SMART
low complexity region	2619	2629	N/A	INTRINSIC
low complexity region	2750	2763	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108251
AA Change: C397S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: C397S

Domain	Start	End	E-Value	Type
RasGAP	1189	1538	1.23e-153	SMART
SEC14	1564	1716	2.36e-11	SMART
low complexity region	2598	2608	N/A	INTRINSIC
low complexity region	2729	2742	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131800

Predicted Effect

probably damaging
Transcript: ENSMUST00000219057
AA Change: C397S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.9609

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 94.9%
20x: 88.1%

Validation Efficiency

95% (57/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]

Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago4	A	G	4: 126,507,132	V640A	probably benign	Het
AI661453	C	T	17: 47,467,928	Q860*	probably null	Het
Atp10d	A	G	5: 72,261,126		probably benign	Het
Axdnd1	A	G	1: 156,378,380		probably null	Het
Bivm	T	A	1: 44,126,703	N104K	possibly damaging	Het
Capn15	A	G	17: 25,964,692	S338P	probably benign	Het
Car9	G	T	4: 43,512,439		probably null	Het
Col13a1	G	A	10: 61,894,069		probably benign	Het
Crb2	A	G	2: 37,792,069	N821D	probably damaging	Het
D5Ertd579e	T	A	5: 36,613,737	I1105F	probably damaging	Het
Dnaja2	A	T	8: 85,540,088	F337I	probably damaging	Het
Dntt	C	T	19: 41,037,139		probably benign	Het
Dock3	C	T	9: 106,914,632	E1381K	possibly damaging	Het
Fam213b	C	A	4: 154,898,128	R107L	probably damaging	Het
Fibp	T	C	19: 5,461,391	Y96H	probably damaging	Het
Garnl3	A	G	2: 33,052,214	V85A	probably damaging	Het
Gsdme	A	T	6: 50,246,128		probably null	Het
Gucy2c	A	T	6: 136,743,914		probably null	Het
Hectd1	A	G	12: 51,762,434	V1748A	probably benign	Het
Hepacam2	G	A	6: 3,467,530	Q384*	probably null	Het
Itga10	T	A	3: 96,657,477	M961K	probably benign	Het
Kcnk1	C	T	8: 126,025,228	T191I	probably benign	Het
Khdrbs1	G	A	4: 129,720,752	P336L	probably benign	Het
Klhdc2	T	A	12: 69,305,710		probably null	Het
Lipc	T	C	9: 70,798,367	H478R	probably benign	Het
Lrp12	A	T	15: 39,878,250	C356*	probably null	Het
Nox3	A	G	17: 3,650,121	F439S	probably damaging	Het
Olfr1121	T	A	2: 87,372,357	V275E	probably benign	Het
Olfr1271	A	T	2: 90,266,346	L28Q	probably damaging	Het
Olfr401	T	C	11: 74,122,213	L308P	possibly damaging	Het
Olfr46	T	C	7: 140,610,709	V181A	probably damaging	Het
Olfr64	A	G	7: 103,893,730	W2R	probably benign	Het
Olfr847	T	G	9: 19,375,414	S156R	possibly damaging	Het
Olfr884	G	A	9: 38,047,815	V198I	probably benign	Het
Pcif1	T	C	2: 164,886,767	F288L	probably damaging	Het
Skint7	G	T	4: 111,980,324	A100S	possibly damaging	Het
Ssu2	A	T	6: 112,374,846	L306*	probably null	Het
Tasp1	T	C	2: 140,057,421	E4G	probably damaging	Het
Tfb1m	A	T	17: 3,545,680	D99E	probably benign	Het
Ube3b	A	G	5: 114,406,137		probably null	Het
Uox	A	G	3: 146,624,575	D162G	probably damaging	Het
Usp18	A	G	6: 121,262,692	T249A	possibly damaging	Het
Vmn1r202	T	C	13: 22,501,716	N177S	probably benign	Het
Vwa2	T	A	19: 56,909,126	M621K	probably damaging	Het
Wdfy3	C	A	5: 101,898,552	D1797Y	probably damaging	Het
Wisp3	C	T	10: 39,158,306	C100Y	probably damaging	Het
Ylpm1	A	T	12: 85,014,082		probably benign	Het
Zbtb9	G	A	17: 26,974,406	V262I	probably benign	Het

Other mutations in Nf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Nf1	APN	11	79395905	missense	probably damaging	0.99
IGL00801:Nf1	APN	11	79428700	splice site	probably benign
IGL00823:Nf1	APN	11	79565517	missense	probably damaging	1.00
IGL00945:Nf1	APN	11	79469803	missense	probably damaging	0.99
IGL00960:Nf1	APN	11	79445121	missense	probably damaging	1.00
IGL01118:Nf1	APN	11	79546986	missense	probably damaging	0.99
IGL01604:Nf1	APN	11	79441709	splice site	probably benign
IGL01637:Nf1	APN	11	79547120	missense	probably damaging	1.00
IGL01659:Nf1	APN	11	79559449	missense	probably benign
IGL01764:Nf1	APN	11	79384187	missense	probably benign
IGL01772:Nf1	APN	11	79390249	missense	probably damaging	1.00
IGL02047:Nf1	APN	11	79425535	missense	probably benign	0.04
IGL02052:Nf1	APN	11	79412727	missense	probably damaging	1.00
IGL02071:Nf1	APN	11	79444121	missense	possibly damaging	0.96
IGL02312:Nf1	APN	11	79444648	missense	possibly damaging	0.95
IGL02341:Nf1	APN	11	79564926	missense	probably benign	0.33
IGL02390:Nf1	APN	11	79565935	missense	possibly damaging	0.64
IGL02390:Nf1	APN	11	79411676	splice site	probably benign
IGL02475:Nf1	APN	11	79535667	missense	probably damaging	1.00
IGL02567:Nf1	APN	11	79547143	missense	probably damaging	1.00
IGL02571:Nf1	APN	11	79428627	missense	probably damaging	1.00
IGL02664:Nf1	APN	11	79444598	critical splice acceptor site	probably null
IGL02664:Nf1	APN	11	79444599	critical splice acceptor site	probably null
IGL02992:Nf1	APN	11	79434933	splice site	probably benign
IGL03006:Nf1	APN	11	79545431	missense	probably damaging	1.00
IGL03216:Nf1	APN	11	79564895	missense	probably benign	0.17
Diesel	UTSW	11	79556723	missense	probably damaging	0.96
Franklin	UTSW	11	79473320	splice site	probably null
Gasoline	UTSW	11	79556789	missense	probably benign	0.17
hancock	UTSW	11	79536850	missense	probably benign
independence	UTSW	11	79454310	intron	probably benign
jackson	UTSW	11	79447572	missense	probably damaging	1.00
Jefferson	UTSW	11	79446864	missense	probably damaging	1.00
Phyletic_dwarf	UTSW	11	79454189	missense	probably damaging	1.00
responsibility	UTSW	11	79565975	missense	probably damaging	0.99
C9142:Nf1	UTSW	11	79556731	missense	probably damaging	0.98
I2289:Nf1	UTSW	11	79547776	missense	probably damaging	1.00
R0055:Nf1	UTSW	11	79471551	missense	probably damaging	1.00
R0055:Nf1	UTSW	11	79471551	missense	probably damaging	1.00
R0081:Nf1	UTSW	11	79453979	splice site	probably benign
R0115:Nf1	UTSW	11	79468876	critical splice donor site	probably null
R0144:Nf1	UTSW	11	79547127	missense	probably damaging	1.00
R0196:Nf1	UTSW	11	79468769	missense	possibly damaging	0.94
R0196:Nf1	UTSW	11	79578272	missense	probably damaging	1.00
R0217:Nf1	UTSW	11	79428574	splice site	probably benign
R0238:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0238:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0239:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0239:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0255:Nf1	UTSW	11	79408699	splice site	probably null
R0362:Nf1	UTSW	11	79536878	missense	probably damaging	1.00
R0364:Nf1	UTSW	11	79441957	nonsense	probably null
R0464:Nf1	UTSW	11	79556789	missense	probably benign	0.17
R0511:Nf1	UTSW	11	79438769	missense	probably benign	0.01
R0549:Nf1	UTSW	11	79468771	missense	probably damaging	0.99
R0585:Nf1	UTSW	11	79568701	missense	probably damaging	0.99
R0636:Nf1	UTSW	11	79535703	missense	probably damaging	0.99
R0924:Nf1	UTSW	11	79453866	missense	probably damaging	0.98
R0942:Nf1	UTSW	11	79438711	missense	probably benign	0.00
R1022:Nf1	UTSW	11	79547033	missense	probably damaging	1.00
R1024:Nf1	UTSW	11	79547033	missense	probably damaging	1.00
R1365:Nf1	UTSW	11	79547885	splice site	probably null
R1395:Nf1	UTSW	11	79535983	missense	possibly damaging	0.49
R1467:Nf1	UTSW	11	79428626	missense	possibly damaging	0.88
R1467:Nf1	UTSW	11	79428626	missense	possibly damaging	0.88
R1477:Nf1	UTSW	11	79395859	nonsense	probably null
R1508:Nf1	UTSW	11	79440909	missense	probably damaging	1.00
R1512:Nf1	UTSW	11	79390369	missense	probably damaging	1.00
R1605:Nf1	UTSW	11	79440923	missense	probably benign	0.01
R1680:Nf1	UTSW	11	79550998	nonsense	probably null
R1704:Nf1	UTSW	11	79463301	splice site	probably null
R1707:Nf1	UTSW	11	79535604	missense	probably damaging	1.00
R1741:Nf1	UTSW	11	79443931	missense	probably benign
R1761:Nf1	UTSW	11	79384265	missense	probably damaging	1.00
R1800:Nf1	UTSW	11	79553968	missense	possibly damaging	0.94
R1873:Nf1	UTSW	11	79547161	missense	probably damaging	1.00
R1966:Nf1	UTSW	11	79411564	missense	possibly damaging	0.72
R1967:Nf1	UTSW	11	79412745	missense	probably damaging	0.96
R1970:Nf1	UTSW	11	79553961	missense	probably benign	0.08
R2059:Nf1	UTSW	11	79556723	missense	probably damaging	0.96
R2105:Nf1	UTSW	11	79469826	missense	possibly damaging	0.50
R2151:Nf1	UTSW	11	79447570	missense	possibly damaging	0.94
R2211:Nf1	UTSW	11	79444064	missense	probably benign	0.39
R2497:Nf1	UTSW	11	79443884	missense	probably damaging	1.00
R2899:Nf1	UTSW	11	79412758	missense	possibly damaging	0.93
R3086:Nf1	UTSW	11	79546986	missense	probably damaging	1.00
R3120:Nf1	UTSW	11	79564899	missense	probably damaging	0.99
R3744:Nf1	UTSW	11	79548747	missense	probably benign	0.23
R3801:Nf1	UTSW	11	79559521	missense	probably null	0.98
R3804:Nf1	UTSW	11	79559521	missense	probably null	0.98
R4212:Nf1	UTSW	11	79469798	missense	probably damaging	1.00
R4298:Nf1	UTSW	11	79384244	missense	probably damaging	1.00
R4578:Nf1	UTSW	11	79445759	missense	probably damaging	1.00
R4579:Nf1	UTSW	11	79468757	missense	probably damaging	1.00
R4587:Nf1	UTSW	11	79536037	critical splice donor site	probably null
R4793:Nf1	UTSW	11	79447572	missense	probably damaging	1.00
R4834:Nf1	UTSW	11	79546297	missense	probably damaging	1.00
R4863:Nf1	UTSW	11	79409409	missense	probably damaging	1.00
R4967:Nf1	UTSW	11	79565553	critical splice donor site	probably null
R4971:Nf1	UTSW	11	79444643	missense	probably damaging	1.00
R5034:Nf1	UTSW	11	79444150	missense	probably damaging	0.98
R5036:Nf1	UTSW	11	79446864	missense	probably damaging	1.00
R5207:Nf1	UTSW	11	79454189	missense	probably damaging	1.00
R5348:Nf1	UTSW	11	79564899	missense	probably damaging	1.00
R5356:Nf1	UTSW	11	79473456	missense	possibly damaging	0.94
R5444:Nf1	UTSW	11	79443959	missense	possibly damaging	0.94
R5533:Nf1	UTSW	11	79445789	missense	probably damaging	0.99
R5918:Nf1	UTSW	11	79569222	intron	probably benign
R5978:Nf1	UTSW	11	79540419	missense	probably damaging	1.00
R6140:Nf1	UTSW	11	79473320	splice site	probably null
R6195:Nf1	UTSW	11	79565975	missense	probably damaging	0.99
R6216:Nf1	UTSW	11	79411607	missense	possibly damaging	0.93
R6233:Nf1	UTSW	11	79565975	missense	probably damaging	0.99
R6257:Nf1	UTSW	11	79549491	missense	probably damaging	1.00
R6258:Nf1	UTSW	11	79565755	splice site	probably null
R6756:Nf1	UTSW	11	79444587	splice site	probably null
R6878:Nf1	UTSW	11	79434882	missense	probably damaging	1.00
R6959:Nf1	UTSW	11	79549468	missense	probably damaging	0.98
R7007:Nf1	UTSW	11	79447023	splice site	probably null
R7066:Nf1	UTSW	11	79556720	missense	probably damaging	1.00
R7099:Nf1	UTSW	11	79570330	missense	probably benign	0.08
R7213:Nf1	UTSW	11	79469819	missense	probably benign	0.23
R7326:Nf1	UTSW	11	79564943	missense	probably benign
R7348:Nf1	UTSW	11	79536850	missense	probably benign
R7380:Nf1	UTSW	11	79546276	missense	probably damaging	1.00
R7407:Nf1	UTSW	11	79448143	missense	probably damaging	1.00
R7412:Nf1	UTSW	11	79473414	missense	probably damaging	1.00
R7545:Nf1	UTSW	11	79409524	missense	probably benign
R7567:Nf1	UTSW	11	79547226	missense	probably damaging	0.99
R7574:Nf1	UTSW	11	79408769	missense	probably null	0.99
R7616:Nf1	UTSW	11	79384266	missense	probably damaging	0.97
R7713:Nf1	UTSW	11	79425606	missense	probably benign
R7737:Nf1	UTSW	11	79545488	missense	probably benign	0.33
R7869:Nf1	UTSW	11	79418588	missense	probably damaging	1.00
R7905:Nf1	UTSW	11	79547112	missense	possibly damaging	0.80
R8232:Nf1	UTSW	11	79578331	missense	probably damaging	0.96
R8244:Nf1	UTSW	11	79440924	missense	probably benign
R8397:Nf1	UTSW	11	79547692	missense	probably damaging	1.00
R8436:Nf1	UTSW	11	79458883	missense	probably damaging	0.99
R8492:Nf1	UTSW	11	79408422	missense	probably benign	0.06
R8719:Nf1	UTSW	11	79390293	missense	possibly damaging	0.86
R8735:Nf1	UTSW	11	79454310	intron	probably benign
R8795:Nf1	UTSW	11	79425616	missense	probably damaging	1.00
R8797:Nf1	UTSW	11	79475885	critical splice donor site	probably benign
R8809:Nf1	UTSW	11	79547138	missense	probably damaging	0.99
R8812:Nf1	UTSW	11	79546354	missense	probably damaging	0.96
R8815:Nf1	UTSW	11	79441665	missense	probably damaging	1.00
R8828:Nf1	UTSW	11	79395853	critical splice acceptor site	probably null
R8894:Nf1	UTSW	11	79445793	missense	probably damaging	1.00
R9051:Nf1	UTSW	11	79473342	missense	probably damaging	1.00
R9103:Nf1	UTSW	11	79559506	missense	probably damaging	0.99
R9142:Nf1	UTSW	11	79471489	missense	probably damaging	1.00
R9142:Nf1	UTSW	11	79475862	missense	probably damaging	1.00
R9170:Nf1	UTSW	11	79545465	missense	probably damaging	1.00
R9201:Nf1	UTSW	11	79570330	missense	probably benign	0.08
R9267:Nf1	UTSW	11	79440890	missense	possibly damaging	0.72
R9309:Nf1	UTSW	11	79468769	missense	possibly damaging	0.94
R9340:Nf1	UTSW	11	79556803	missense	possibly damaging	0.90
R9398:Nf1	UTSW	11	79547192	missense	probably damaging	0.99
R9471:Nf1	UTSW	11	79545369	missense	probably damaging	0.99
X0052:Nf1	UTSW	11	79559416	missense	probably damaging	0.99
Z1177:Nf1	UTSW	11	79564925	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCTTTCGGATAAGCCCTCACAAC -3'
(R):5'- GGGAAGCTCTGCTTTACAGAAAGGTC -3'

Sequencing Primer
(F):5'- tatgggggtgacggagg -3'
(R):5'- GCTTTACAGAAAGGTCTAAGTTCAG -3'

Posted On

2014-03-14