Mutagenetix > Incidental Mutation

Incidental Mutation 'R1350:Hectd1'

159541

Institutional Source

Beutler Lab

Gene Symbol

Hectd1

Ensembl Gene

ENSMUSG00000035247

Gene Name

HECT domain E3 ubiquitin protein ligase 1

Synonyms

b2b327Clo, opm, A630086P08Rik

MMRRC Submission

039415-MU

Accession Numbers

Genbank: NM_144788; MGI: 2384768

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1350 (G1)

Quality Score

152

Status

Validated

Chromosome

Chromosomal Location

51743722-51829536 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 51762434 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1748 (V1748A)

Ref Sequence

ENSEMBL: ENSMUSP00000136449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042052] [ENSMUST00000179265]

AlphaFold

Q69ZR2

Predicted Effect

probably benign
Transcript: ENSMUST00000042052
AA Change: V1743A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000046766
Gene: ENSMUSG00000035247
AA Change: V1743A

Domain	Start	End	E-Value	Type
low complexity region	317	331	N/A	INTRINSIC
ANK	395	424	1.44e-1	SMART
ANK	426	455	2.81e-4	SMART
ANK	459	488	1.55e2	SMART
low complexity region	490	509	N/A	INTRINSIC
low complexity region	630	654	N/A	INTRINSIC
low complexity region	707	723	N/A	INTRINSIC
low complexity region	821	832	N/A	INTRINSIC
Pfam:Sad1_UNC	1107	1240	9.2e-27	PFAM
low complexity region	1259	1271	N/A	INTRINSIC
Pfam:MIB_HERC2	1277	1338	7.6e-27	PFAM
low complexity region	1373	1401	N/A	INTRINSIC
low complexity region	1441	1458	N/A	INTRINSIC
low complexity region	1484	1495	N/A	INTRINSIC
low complexity region	1508	1524	N/A	INTRINSIC
low complexity region	1600	1630	N/A	INTRINSIC
low complexity region	1633	1651	N/A	INTRINSIC
low complexity region	1674	1703	N/A	INTRINSIC
low complexity region	1745	1752	N/A	INTRINSIC
PDB:2LC3\|A	1879	1966	4e-57	PDB
low complexity region	2101	2117	N/A	INTRINSIC
HECTc	2143	2610	8.32e-76	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179265
AA Change: V1748A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000136449
Gene: ENSMUSG00000035247
AA Change: V1748A

Domain	Start	End	E-Value	Type
low complexity region	317	331	N/A	INTRINSIC
ANK	396	425	1.44e-1	SMART
ANK	427	456	2.81e-4	SMART
ANK	460	489	1.55e2	SMART
low complexity region	491	510	N/A	INTRINSIC
low complexity region	631	655	N/A	INTRINSIC
low complexity region	708	724	N/A	INTRINSIC
low complexity region	822	833	N/A	INTRINSIC
Pfam:Sad1_UNC	1112	1245	1.3e-26	PFAM
low complexity region	1264	1276	N/A	INTRINSIC
Pfam:MIB_HERC2	1282	1341	5.3e-26	PFAM
low complexity region	1378	1406	N/A	INTRINSIC
low complexity region	1446	1463	N/A	INTRINSIC
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1513	1529	N/A	INTRINSIC
low complexity region	1605	1635	N/A	INTRINSIC
low complexity region	1638	1656	N/A	INTRINSIC
low complexity region	1679	1708	N/A	INTRINSIC
low complexity region	1750	1757	N/A	INTRINSIC
PDB:2LC3\|A	1884	1971	3e-57	PDB
low complexity region	2106	2122	N/A	INTRINSIC
HECTc	2148	2618	4.5e-72	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218626

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 94.9%
20x: 88.1%

Validation Efficiency

95% (57/60)

MGI Phenotype

PHENOTYPE: Mice that are homozygous for either a gene trapped or an ENU-induced allele exhibit exencephaly associated with impaired head mesenchyme development and neural tube closure, and show eye and cranial vault dysplasia. Homozygotes for another ENU-induced allele show congenital cardiovascular defects. [provided by MGI curators]

Allele List at MGI

All alleles(30) : Gene trapped(29) Chemically induced(1)

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago4	A	G	4: 126,507,132	V640A	probably benign	Het
AI661453	C	T	17: 47,467,928	Q860*	probably null	Het
Atp10d	A	G	5: 72,261,126		probably benign	Het
Axdnd1	A	G	1: 156,378,380		probably null	Het
Bivm	T	A	1: 44,126,703	N104K	possibly damaging	Het
Capn15	A	G	17: 25,964,692	S338P	probably benign	Het
Car9	G	T	4: 43,512,439		probably null	Het
Col13a1	G	A	10: 61,894,069		probably benign	Het
Crb2	A	G	2: 37,792,069	N821D	probably damaging	Het
D5Ertd579e	T	A	5: 36,613,737	I1105F	probably damaging	Het
Dnaja2	A	T	8: 85,540,088	F337I	probably damaging	Het
Dntt	C	T	19: 41,037,139		probably benign	Het
Dock3	C	T	9: 106,914,632	E1381K	possibly damaging	Het
Fam213b	C	A	4: 154,898,128	R107L	probably damaging	Het
Fibp	T	C	19: 5,461,391	Y96H	probably damaging	Het
Garnl3	A	G	2: 33,052,214	V85A	probably damaging	Het
Gsdme	A	T	6: 50,246,128		probably null	Het
Gucy2c	A	T	6: 136,743,914		probably null	Het
Hepacam2	G	A	6: 3,467,530	Q384*	probably null	Het
Itga10	T	A	3: 96,657,477	M961K	probably benign	Het
Kcnk1	C	T	8: 126,025,228	T191I	probably benign	Het
Khdrbs1	G	A	4: 129,720,752	P336L	probably benign	Het
Klhdc2	T	A	12: 69,305,710		probably null	Het
Lipc	T	C	9: 70,798,367	H478R	probably benign	Het
Lrp12	A	T	15: 39,878,250	C356*	probably null	Het
Nf1	T	A	11: 79,412,687	C397S	probably damaging	Het
Nox3	A	G	17: 3,650,121	F439S	probably damaging	Het
Olfr1121	T	A	2: 87,372,357	V275E	probably benign	Het
Olfr1271	A	T	2: 90,266,346	L28Q	probably damaging	Het
Olfr401	T	C	11: 74,122,213	L308P	possibly damaging	Het
Olfr46	T	C	7: 140,610,709	V181A	probably damaging	Het
Olfr64	A	G	7: 103,893,730	W2R	probably benign	Het
Olfr847	T	G	9: 19,375,414	S156R	possibly damaging	Het
Olfr884	G	A	9: 38,047,815	V198I	probably benign	Het
Pcif1	T	C	2: 164,886,767	F288L	probably damaging	Het
Skint7	G	T	4: 111,980,324	A100S	possibly damaging	Het
Ssu2	A	T	6: 112,374,846	L306*	probably null	Het
Tasp1	T	C	2: 140,057,421	E4G	probably damaging	Het
Tfb1m	A	T	17: 3,545,680	D99E	probably benign	Het
Ube3b	A	G	5: 114,406,137		probably null	Het
Uox	A	G	3: 146,624,575	D162G	probably damaging	Het
Usp18	A	G	6: 121,262,692	T249A	possibly damaging	Het
Vmn1r202	T	C	13: 22,501,716	N177S	probably benign	Het
Vwa2	T	A	19: 56,909,126	M621K	probably damaging	Het
Wdfy3	C	A	5: 101,898,552	D1797Y	probably damaging	Het
Wisp3	C	T	10: 39,158,306	C100Y	probably damaging	Het
Ylpm1	A	T	12: 85,014,082		probably benign	Het
Zbtb9	G	A	17: 26,974,406	V262I	probably benign	Het

Other mutations in Hectd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Hectd1	APN	12	51769108	missense	possibly damaging	0.94
IGL00402:Hectd1	APN	12	51759432	missense	probably benign
IGL00419:Hectd1	APN	12	51764035	missense	probably damaging	0.99
IGL00518:Hectd1	APN	12	51776489	splice site	probably benign
IGL00565:Hectd1	APN	12	51790398	missense	probably damaging	0.97
IGL00574:Hectd1	APN	12	51774004	missense	probably benign	0.17
IGL00576:Hectd1	APN	12	51759309	missense	probably damaging	0.99
IGL00788:Hectd1	APN	12	51748788	missense	probably damaging	0.99
IGL00978:Hectd1	APN	12	51791390	missense	possibly damaging	0.95
IGL01328:Hectd1	APN	12	51761121	missense	probably damaging	1.00
IGL01337:Hectd1	APN	12	51802274	missense	possibly damaging	0.95
IGL01634:Hectd1	APN	12	51803779	missense	probably damaging	0.98
IGL01731:Hectd1	APN	12	51802810	missense	possibly damaging	0.59
IGL01920:Hectd1	APN	12	51782554	missense	probably damaging	0.99
IGL01951:Hectd1	APN	12	51794497	nonsense	probably null
IGL01994:Hectd1	APN	12	51797942	missense	probably damaging	0.99
IGL02140:Hectd1	APN	12	51774137	missense	probably damaging	0.99
IGL02150:Hectd1	APN	12	51769191	missense	probably damaging	0.97
IGL02156:Hectd1	APN	12	51754133	splice site	probably benign
IGL02177:Hectd1	APN	12	51772320	missense	probably damaging	0.99
IGL02502:Hectd1	APN	12	51797852	missense	possibly damaging	0.77
IGL02505:Hectd1	APN	12	51800713	critical splice donor site	probably null
IGL02519:Hectd1	APN	12	51769111	missense	probably damaging	0.99
IGL02624:Hectd1	APN	12	51762450	missense	possibly damaging	0.61
IGL02833:Hectd1	APN	12	51764081	missense	probably damaging	0.96
IGL02851:Hectd1	APN	12	51767640	missense	possibly damaging	0.94
IGL02866:Hectd1	APN	12	51790613	missense	probably damaging	1.00
IGL02981:Hectd1	APN	12	51768887	missense	possibly damaging	0.70
IGL02987:Hectd1	APN	12	51744767	missense	probably damaging	1.00
IGL02999:Hectd1	APN	12	51827422	missense	possibly damaging	0.77
IGL03071:Hectd1	APN	12	51769174	missense	probably benign	0.00
IGL03078:Hectd1	APN	12	51802236	missense	probably damaging	0.98
IGL03299:Hectd1	APN	12	51800888	splice site	probably benign
3-1:Hectd1	UTSW	12	51753807	missense	probably damaging	0.99
R0039:Hectd1	UTSW	12	51753825	missense	possibly damaging	0.83
R0238:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0238:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0239:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0239:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0268:Hectd1	UTSW	12	51769107	missense	probably damaging	0.99
R0268:Hectd1	UTSW	12	51769108	missense	possibly damaging	0.94
R0409:Hectd1	UTSW	12	51782556	missense	possibly damaging	0.59
R1019:Hectd1	UTSW	12	51748657	missense	probably damaging	0.99
R1072:Hectd1	UTSW	12	51761072	missense	probably benign	0.11
R1087:Hectd1	UTSW	12	51776572	missense	probably damaging	0.99
R1165:Hectd1	UTSW	12	51764164	splice site	probably benign
R1553:Hectd1	UTSW	12	51773878	missense	probably damaging	0.98
R1666:Hectd1	UTSW	12	51753824	missense	possibly damaging	0.91
R1676:Hectd1	UTSW	12	51744788	missense	probably damaging	1.00
R1694:Hectd1	UTSW	12	51744592	missense	probably damaging	1.00
R1778:Hectd1	UTSW	12	51753807	missense	probably damaging	0.99
R1856:Hectd1	UTSW	12	51744794	missense	probably damaging	1.00
R1859:Hectd1	UTSW	12	51806567	missense	probably damaging	1.00
R1884:Hectd1	UTSW	12	51800955	missense	probably benign	0.00
R1982:Hectd1	UTSW	12	51785841	missense	probably damaging	0.97
R2034:Hectd1	UTSW	12	51757116	splice site	probably null
R2061:Hectd1	UTSW	12	51794444	missense	probably damaging	0.99
R2078:Hectd1	UTSW	12	51748542	missense	probably damaging	0.99
R2176:Hectd1	UTSW	12	51745494	missense	probably damaging	1.00
R2210:Hectd1	UTSW	12	51806462	missense	probably damaging	0.99
R2248:Hectd1	UTSW	12	51806471	missense	probably damaging	0.99
R2282:Hectd1	UTSW	12	51769008	missense	possibly damaging	0.95
R2402:Hectd1	UTSW	12	51745534	missense	probably benign	0.01
R3876:Hectd1	UTSW	12	51768730	missense	probably damaging	0.98
R4027:Hectd1	UTSW	12	51802436	critical splice acceptor site	probably null
R4085:Hectd1	UTSW	12	51774750	missense	possibly damaging	0.93
R4115:Hectd1	UTSW	12	51768723	nonsense	probably null
R4116:Hectd1	UTSW	12	51768723	nonsense	probably null
R4169:Hectd1	UTSW	12	51790225	missense	probably damaging	0.97
R4434:Hectd1	UTSW	12	51752052	missense	probably damaging	1.00
R4507:Hectd1	UTSW	12	51790493	missense	probably damaging	0.97
R4578:Hectd1	UTSW	12	51751932	missense	probably damaging	1.00
R4579:Hectd1	UTSW	12	51744573	missense	probably damaging	0.97
R4709:Hectd1	UTSW	12	51787912	missense	possibly damaging	0.94
R4812:Hectd1	UTSW	12	51827351	critical splice donor site	probably null
R4883:Hectd1	UTSW	12	51784247	nonsense	probably null
R4885:Hectd1	UTSW	12	51800722	missense	probably damaging	0.97
R4975:Hectd1	UTSW	12	51762497	missense	probably benign	0.02
R4983:Hectd1	UTSW	12	51784262	missense	probably benign	0.01
R5007:Hectd1	UTSW	12	51802660	missense	possibly damaging	0.95
R5046:Hectd1	UTSW	12	51750388	missense	probably damaging	1.00
R5062:Hectd1	UTSW	12	51744879	missense	probably damaging	0.98
R5164:Hectd1	UTSW	12	51827489	start codon destroyed	probably null	0.60
R5213:Hectd1	UTSW	12	51802533	critical splice donor site	probably null
R5535:Hectd1	UTSW	12	51802326	missense	probably damaging	0.98
R5776:Hectd1	UTSW	12	51764114	missense	possibly damaging	0.91
R5846:Hectd1	UTSW	12	51773835	missense	probably damaging	0.99
R5907:Hectd1	UTSW	12	51798754	missense	probably damaging	0.98
R5911:Hectd1	UTSW	12	51802252	missense	probably damaging	0.99
R5919:Hectd1	UTSW	12	51769072	missense	probably damaging	0.98
R6051:Hectd1	UTSW	12	51754104	missense	probably benign
R6141:Hectd1	UTSW	12	51746092	critical splice donor site	probably null
R6172:Hectd1	UTSW	12	51769282	missense	probably damaging	1.00
R6194:Hectd1	UTSW	12	51748445	missense	probably damaging	0.99
R6356:Hectd1	UTSW	12	51744619	missense	probably damaging	1.00
R6795:Hectd1	UTSW	12	51794487	missense	possibly damaging	0.94
R6909:Hectd1	UTSW	12	51764162	splice site	probably null
R6971:Hectd1	UTSW	12	51748743	nonsense	probably null
R7079:Hectd1	UTSW	12	51787855	missense	possibly damaging	0.96
R7104:Hectd1	UTSW	12	51827351	critical splice donor site	probably null
R7171:Hectd1	UTSW	12	51759297	missense	probably damaging	0.99
R7296:Hectd1	UTSW	12	51785852	missense	possibly damaging	0.73
R7346:Hectd1	UTSW	12	51750321	missense	probably benign
R7355:Hectd1	UTSW	12	51791298	missense	possibly damaging	0.72
R7468:Hectd1	UTSW	12	51744805	splice site	probably null
R7531:Hectd1	UTSW	12	51806367	missense	probably benign	0.33
R7532:Hectd1	UTSW	12	51790450	missense	probably damaging	0.98
R7755:Hectd1	UTSW	12	51802220	missense	possibly damaging	0.86
R7807:Hectd1	UTSW	12	51745388	missense	probably damaging	1.00
R7842:Hectd1	UTSW	12	51772560	missense	probably damaging	0.99
R7922:Hectd1	UTSW	12	51790195	nonsense	probably null
R8059:Hectd1	UTSW	12	51790378	missense	possibly damaging	0.53
R8085:Hectd1	UTSW	12	51748896	missense	probably damaging	0.97
R8145:Hectd1	UTSW	12	51784233	missense	possibly damaging	0.72
R8157:Hectd1	UTSW	12	51791290	missense	possibly damaging	0.53
R8405:Hectd1	UTSW	12	51827395	missense	probably benign	0.01
R8505:Hectd1	UTSW	12	51750362	missense	probably damaging	1.00
R8511:Hectd1	UTSW	12	51787871	missense	probably benign	0.01
R8697:Hectd1	UTSW	12	51772537	critical splice donor site	probably benign
R8725:Hectd1	UTSW	12	51802217	missense	possibly damaging	0.92
R8727:Hectd1	UTSW	12	51802217	missense	possibly damaging	0.92
R8911:Hectd1	UTSW	12	51748833	missense	probably damaging	0.99
R8983:Hectd1	UTSW	12	51744627	missense	probably damaging	0.97
R9037:Hectd1	UTSW	12	51785882	missense	possibly damaging	0.85
R9219:Hectd1	UTSW	12	51753829	missense	probably damaging	0.99
R9413:Hectd1	UTSW	12	51746097	nonsense	probably null
R9456:Hectd1	UTSW	12	51785801	missense	probably benign
R9513:Hectd1	UTSW	12	51769296	missense	possibly damaging	0.92
R9640:Hectd1	UTSW	12	51748414	nonsense	probably null
R9641:Hectd1	UTSW	12	51769264	missense	probably benign	0.00
R9713:Hectd1	UTSW	12	51776545	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TGCCTATGTGTACTCAGAGACCAAGATG -3'
(R):5'- GGGGCTAGACTGATTGAAGAGTGTAGAT -3'

Sequencing Primer
(F):5'- CAGTTTCAAGTAAGAAACTCCTGC -3'
(R):5'- TCTTAGATTCTGAGACGTCCCT -3'

Posted On

2014-03-14