Incidental Mutation 'R1350:Klhdc2'
ID159542
Institutional Source Beutler Lab
Gene Symbol Klhdc2
Ensembl Gene ENSMUSG00000020978
Gene Namekelch domain containing 2
SynonymsHCLP-1, D12Ertd522e, 2310022K15Rik
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1350 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location69296681-69310687 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 69305710 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021362] [ENSMUST00000021368]
Predicted Effect probably null
Transcript: ENSMUST00000021362
SMART Domains Protein: ENSMUSP00000021362
Gene: ENSMUSG00000020978

DomainStartEndE-ValueType
internal_repeat_1 7 117 3.66e-6 PROSPERO
internal_repeat_2 66 163 6.25e-5 PROSPERO
Pfam:Kelch_1 217 258 1.4e-6 PFAM
Pfam:Kelch_2 217 262 1.2e-7 PFAM
Pfam:Kelch_4 217 266 8.4e-8 PFAM
Pfam:Kelch_3 227 276 5.1e-9 PFAM
Pfam:Kelch_5 265 305 1.4e-6 PFAM
Pfam:Kelch_4 267 310 2e-9 PFAM
Pfam:Kelch_3 278 326 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021368
SMART Domains Protein: ENSMUSP00000021368
Gene: ENSMUSG00000020982

DomainStartEndE-ValueType
Pfam:FbpA 6 523 5.5e-42 PFAM
Pfam:DUF814 530 630 9e-27 PFAM
low complexity region 697 708 N/A INTRINSIC
low complexity region 861 879 N/A INTRINSIC
low complexity region 894 918 N/A INTRINSIC
Pfam:DUF3441 956 1055 9.8e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154667
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Klhdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Klhdc2 APN 12 69303534 missense probably benign 0.04
IGL00990:Klhdc2 APN 12 69307213 missense probably benign 0.30
IGL01024:Klhdc2 APN 12 69305836 missense probably benign 0.01
IGL01457:Klhdc2 APN 12 69297053 missense probably benign
IGL01735:Klhdc2 APN 12 69300279 missense probably benign 0.39
IGL01913:Klhdc2 APN 12 69302358 missense probably benign 0.45
IGL02440:Klhdc2 APN 12 69303640 missense probably damaging 1.00
Dixit_dominus UTSW 12 69308976 nonsense probably null
R0611:Klhdc2 UTSW 12 69300279 missense probably benign 0.22
R0724:Klhdc2 UTSW 12 69297048 missense probably benign
R1796:Klhdc2 UTSW 12 69300297 critical splice donor site probably null
R1907:Klhdc2 UTSW 12 69296960 start gained probably benign
R4418:Klhdc2 UTSW 12 69307597 unclassified probably benign
R5119:Klhdc2 UTSW 12 69296962 utr 5 prime probably benign
R5586:Klhdc2 UTSW 12 69307693 splice site probably null
R5987:Klhdc2 UTSW 12 69303613 missense possibly damaging 0.71
R6448:Klhdc2 UTSW 12 69303920 missense probably benign
R6848:Klhdc2 UTSW 12 69308976 nonsense probably null
R7824:Klhdc2 UTSW 12 69307228 missense probably damaging 0.98
R7844:Klhdc2 UTSW 12 69302406 missense probably damaging 1.00
R7886:Klhdc2 UTSW 12 69304632 splice site probably null
RF016:Klhdc2 UTSW 12 69303886 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTAGTGCCCAAGTTTCTGACACATTC -3'
(R):5'- TGAACACATGCTGTATCAGGCACATAG -3'

Sequencing Primer
(F):5'- CCCAAGTTTCTGACACATTCTTATTC -3'
(R):5'- ctccctcttctgttgtgtctg -3'
Posted On2014-03-14