Incidental Mutation 'R1350:Vmn1r202'
ID159544
Institutional Source Beutler Lab
Gene Symbol Vmn1r202
Ensembl Gene ENSMUSG00000094379
Gene Namevomeronasal 1 receptor 202
SynonymsV1ri7
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R1350 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location22497750-22505381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22501716 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 177 (N177S)
Ref Sequence ENSEMBL: ENSMUSP00000154314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078642] [ENSMUST00000228020]
Predicted Effect probably benign
Transcript: ENSMUST00000078642
AA Change: N177S

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000077711
Gene: ENSMUSG00000094379
AA Change: N177S

DomainStartEndE-ValueType
Pfam:TAS2R 5 301 2.2e-11 PFAM
Pfam:V1R 35 300 5.6e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228020
AA Change: N177S

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Vmn1r202
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Vmn1r202 APN 13 22501989 missense possibly damaging 0.95
IGL01516:Vmn1r202 APN 13 22501462 missense possibly damaging 0.57
IGL01722:Vmn1r202 APN 13 22501720 missense probably benign 0.00
IGL02641:Vmn1r202 APN 13 22502104 missense probably benign 0.34
IGL02863:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL02876:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL02891:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL02943:Vmn1r202 APN 13 22502194 missense probably benign 0.01
IGL03057:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL03114:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL03114:Vmn1r202 APN 13 22501330 utr 3 prime probably benign
IGL03143:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL03159:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL03097:Vmn1r202 UTSW 13 22501470 missense probably benign 0.00
R0611:Vmn1r202 UTSW 13 22501654 missense probably damaging 1.00
R1666:Vmn1r202 UTSW 13 22501370 missense possibly damaging 0.94
R1668:Vmn1r202 UTSW 13 22501370 missense possibly damaging 0.94
R1803:Vmn1r202 UTSW 13 22502143 missense probably benign 0.00
R2035:Vmn1r202 UTSW 13 22501602 missense probably damaging 0.98
R2112:Vmn1r202 UTSW 13 22501734 missense possibly damaging 0.76
R2145:Vmn1r202 UTSW 13 22501783 missense possibly damaging 0.79
R3026:Vmn1r202 UTSW 13 22501762 missense probably benign 0.03
R3808:Vmn1r202 UTSW 13 22501900 missense possibly damaging 0.83
R4714:Vmn1r202 UTSW 13 22501807 missense probably damaging 1.00
R5016:Vmn1r202 UTSW 13 22502205 missense probably damaging 1.00
R5124:Vmn1r202 UTSW 13 22501750 missense probably benign 0.01
R6136:Vmn1r202 UTSW 13 22501462 missense possibly damaging 0.90
R6365:Vmn1r202 UTSW 13 22502204 missense probably benign 0.12
R6982:Vmn1r202 UTSW 13 22501747 missense probably benign 0.02
R7293:Vmn1r202 UTSW 13 22501702 missense probably benign 0.00
R7502:Vmn1r202 UTSW 13 22502018 missense probably damaging 1.00
R7603:Vmn1r202 UTSW 13 22501620 missense probably damaging 1.00
R7672:Vmn1r202 UTSW 13 22501680 missense probably benign 0.45
R7822:Vmn1r202 UTSW 13 22502071 missense probably damaging 1.00
R8026:Vmn1r202 UTSW 13 22502144 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- GCCACTGTGGAACCTGTGTATAAGG -3'
(R):5'- ACACTGTGGAGAAAGCTCAAACCTC -3'

Sequencing Primer
(F):5'- AGTGAGAACCCTCTGTGTAGC -3'
(R):5'- GAGAAAGCTCAAACCTCAGACAC -3'
Posted On2014-03-14