Incidental Mutation 'R1350:Lrp12'
ID159545
Institutional Source Beutler Lab
Gene Symbol Lrp12
Ensembl Gene ENSMUSG00000022305
Gene Namelow density lipoprotein-related protein 12
Synonyms
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R1350 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location39870589-39943994 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 39878250 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 356 (C356*)
Ref Sequence ENSEMBL: ENSMUSP00000105934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022916] [ENSMUST00000110305] [ENSMUST00000228575]
Predicted Effect probably null
Transcript: ENSMUST00000022916
AA Change: C375*
SMART Domains Protein: ENSMUSP00000022916
Gene: ENSMUSG00000022305
AA Change: C375*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
CUB 47 159 3.23e-28 SMART
LDLa 167 202 1.27e-11 SMART
LDLa 214 256 1.04e-7 SMART
CUB 259 372 9.88e-24 SMART
LDLa 374 412 2.6e-3 SMART
LDLa 413 450 2.36e-6 SMART
LDLa 451 487 5.1e-11 SMART
low complexity region 630 646 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 708 722 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110305
AA Change: C356*
SMART Domains Protein: ENSMUSP00000105934
Gene: ENSMUSG00000022305
AA Change: C356*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CUB 28 140 3.23e-28 SMART
LDLa 148 183 1.27e-11 SMART
LDLa 195 237 1.04e-7 SMART
CUB 240 353 9.88e-24 SMART
LDLa 355 393 2.6e-3 SMART
LDLa 394 431 2.36e-6 SMART
LDLa 432 468 5.1e-11 SMART
low complexity region 611 627 N/A INTRINSIC
low complexity region 634 645 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228575
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor related protein family. The product of this gene is a transmembrane protein that is differentially expressed in many cancer cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Lrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01953:Lrp12 APN 15 39878101 missense probably damaging 1.00
IGL02501:Lrp12 APN 15 39877904 missense probably damaging 1.00
IGL02850:Lrp12 APN 15 39878575 missense probably damaging 1.00
IGL03365:Lrp12 APN 15 39872521 missense probably benign
R0010:Lrp12 UTSW 15 39878276 missense probably damaging 1.00
R0047:Lrp12 UTSW 15 39878239 missense probably damaging 1.00
R0416:Lrp12 UTSW 15 39878911 splice site probably benign
R0840:Lrp12 UTSW 15 39876158 missense probably damaging 1.00
R1053:Lrp12 UTSW 15 39877981 missense probably damaging 1.00
R1158:Lrp12 UTSW 15 39878431 missense probably damaging 1.00
R1288:Lrp12 UTSW 15 39878403 missense probably damaging 1.00
R1416:Lrp12 UTSW 15 39878623 missense probably damaging 1.00
R1548:Lrp12 UTSW 15 39872506 missense probably damaging 0.99
R1691:Lrp12 UTSW 15 39872265 missense probably damaging 1.00
R1696:Lrp12 UTSW 15 39878361 missense probably damaging 0.99
R2050:Lrp12 UTSW 15 39872589 missense probably damaging 0.99
R2513:Lrp12 UTSW 15 39876111 missense probably damaging 1.00
R3415:Lrp12 UTSW 15 39878282 missense probably damaging 1.00
R3417:Lrp12 UTSW 15 39878282 missense probably damaging 1.00
R4118:Lrp12 UTSW 15 39877965 nonsense probably null
R4167:Lrp12 UTSW 15 39885013 missense probably damaging 1.00
R4214:Lrp12 UTSW 15 39872580 missense probably benign 0.33
R4643:Lrp12 UTSW 15 39872022 missense probably damaging 1.00
R5008:Lrp12 UTSW 15 39878456 missense probably damaging 1.00
R5061:Lrp12 UTSW 15 39878254 missense probably damaging 1.00
R5165:Lrp12 UTSW 15 39872461 missense probably benign
R5910:Lrp12 UTSW 15 39876043 intron probably null
R6038:Lrp12 UTSW 15 39872380 missense probably damaging 0.99
R6038:Lrp12 UTSW 15 39872380 missense probably damaging 0.99
R6047:Lrp12 UTSW 15 39872067 missense probably damaging 1.00
R6351:Lrp12 UTSW 15 39878188 missense probably damaging 1.00
R6392:Lrp12 UTSW 15 39872019 missense probably damaging 1.00
R7026:Lrp12 UTSW 15 39880170 missense probably damaging 1.00
R8306:Lrp12 UTSW 15 39878054 missense probably damaging 1.00
Z1176:Lrp12 UTSW 15 39878123 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACGAGGGTAGCAGACACCATTTC -3'
(R):5'- GTAACTGCACCTGGCTGATAGACAC -3'

Sequencing Primer
(F):5'- GTTTGGGCAATGCCAGTAC -3'
(R):5'- CGGAAAGTCATCTTACGGTTCAC -3'
Posted On2014-03-14