Incidental Mutation 'R1350:Tfb1m'
ID159546
Institutional Source Beutler Lab
Gene Symbol Tfb1m
Ensembl Gene ENSMUSG00000036983
Gene Nametranscription factor B1, mitochondrial
Synonyms
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1350 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location3519256-3557781 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3545680 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 99 (D99E)
Ref Sequence ENSEMBL: ENSMUSP00000035291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041003]
PDB Structure
Crystal structure of murine TFB1M [X-RAY DIFFRACTION]
Crystal structure of murine TFB1M in complex with SAM [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000041003
AA Change: D99E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000035291
Gene: ENSMUSG00000036983
AA Change: D99E

DomainStartEndE-ValueType
rADc 43 234 5.56e-69 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232131
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dimethyltransferase that methylates the conserved stem loop of mitochondrial 12S rRNA. The encoded protein also is part of the basal mitochondrial transcription complex and is necessary for mitochondrial gene expression. The methylation and transcriptional activities of this protein are independent of one another. Variations in this gene may influence the severity of aminoglycoside-induced deafness (AID).[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality associated with developmental defects and reduced mitochondrial function at E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Tfb1m
AlleleSourceChrCoordTypePredicted EffectPPH Score
Pistolero UTSW 17 3543147 missense probably benign 0.00
R0141:Tfb1m UTSW 17 3554957 missense probably damaging 1.00
R1557:Tfb1m UTSW 17 3554966 missense probably damaging 0.98
R1924:Tfb1m UTSW 17 3519671 missense probably damaging 1.00
R4076:Tfb1m UTSW 17 3521670 missense probably damaging 1.00
R5928:Tfb1m UTSW 17 3543147 missense probably benign 0.00
R8174:Tfb1m UTSW 17 3519580 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGTGGCCTGCTTTACAACATTTG -3'
(R):5'- GCAGAAACACTGTGGCTTCATTGG -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- TCAGTGCTCACACAGCATTC -3'
Posted On2014-03-14