Incidental Mutation 'R1350:Nox3'
ID159547
Institutional Source Beutler Lab
Gene Symbol Nox3
Ensembl Gene ENSMUSG00000023802
Gene NameNADPH oxidase 3
Synonymsnmf250, het
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R1350 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location3635240-3696261 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3650121 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 439 (F439S)
Ref Sequence ENSEMBL: ENSMUSP00000111466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115800]
Predicted Effect probably damaging
Transcript: ENSMUST00000024565
AA Change: F459S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024565
Gene: ENSMUSG00000023802
AA Change: F459S

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:Ferric_reduct 75 238 8.6e-28 PFAM
Pfam:FAD_binding_8 311 413 4.1e-26 PFAM
Pfam:NAD_binding_6 419 569 1e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115800
AA Change: F439S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111466
Gene: ENSMUSG00000023802
AA Change: F439S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 55 218 5.4e-23 PFAM
Pfam:FAD_binding_6 290 379 1.8e-8 PFAM
Pfam:FAD_binding_8 291 393 1.5e-27 PFAM
Pfam:NAD_binding_6 399 549 1e-34 PFAM
Meta Mutation Damage Score 0.7939 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: This gene encodes a member of the NOX family of NADPH oxidases. These enzymes catalyze the transfer of electrons from NADPH to molecular oxygen to produce superoxide and other reactive oxygen species (ROS). The ROS generated by family members have been implicated in numerous biological functions including host defense, posttranlational processing of proteins, cellular signaling, regulation of gene expression, and cell differentiation. The protein encoded by this gene is expressed predominantly in the inner ear and is involved in the biogenesis of otoconia, which are crystalline structures of the inner ear involved in the perception of gravity and linear acceleration. In mouse mutations of this gene lead to the absence of otoconia and vestibular dysfunction. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous mutants bilaterally lack otoliths in otherwise normal ears and display impaired swimming ability, motor capabilities, and vestibular responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Nox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Nox3 APN 17 3683015 missense probably damaging 0.99
IGL01135:Nox3 APN 17 3696252 utr 5 prime probably benign
IGL01791:Nox3 APN 17 3682943 missense possibly damaging 0.68
IGL02423:Nox3 APN 17 3682916 missense probably damaging 1.00
IGL03091:Nox3 APN 17 3665844 missense probably benign 0.42
R0046:Nox3 UTSW 17 3682961 missense probably benign 0.08
R0046:Nox3 UTSW 17 3682961 missense probably benign 0.08
R0085:Nox3 UTSW 17 3635281 missense probably benign 0.14
R0426:Nox3 UTSW 17 3695563 missense probably damaging 1.00
R0690:Nox3 UTSW 17 3695564 missense probably damaging 1.00
R1281:Nox3 UTSW 17 3696185 missense probably damaging 1.00
R1843:Nox3 UTSW 17 3669878 missense probably damaging 1.00
R1902:Nox3 UTSW 17 3670017 missense probably damaging 1.00
R2023:Nox3 UTSW 17 3694021 splice site probably benign
R2762:Nox3 UTSW 17 3696158 missense probably benign 0.35
R2872:Nox3 UTSW 17 3682916 missense probably damaging 1.00
R2872:Nox3 UTSW 17 3682916 missense probably damaging 1.00
R4429:Nox3 UTSW 17 3682958 missense probably benign 0.05
R4630:Nox3 UTSW 17 3693982 missense possibly damaging 0.53
R4926:Nox3 UTSW 17 3669894 missense probably damaging 1.00
R4928:Nox3 UTSW 17 3635275 missense probably null 1.00
R5181:Nox3 UTSW 17 3635286 nonsense probably null
R6911:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R6912:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R7486:Nox3 UTSW 17 3669944 missense probably damaging 1.00
R7529:Nox3 UTSW 17 3671775 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGAAGCAGTAATGGAGATCCTCGG -3'
(R):5'- GCTTGTCCAGAAGCTCGGAAAGTTG -3'

Sequencing Primer
(F):5'- ATGGAGATCCTCGGTTTTTCTGATAC -3'
(R):5'- CAGAAGCTCGGAAAGTTGATTCTC -3'
Posted On2014-03-14