Incidental Mutation 'R1350:Zbtb9'
ID159549
Institutional Source Beutler Lab
Gene Symbol Zbtb9
Ensembl Gene ENSMUSG00000079605
Gene Namezinc finger and BTB domain containing 9
Synonyms
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R1350 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location26973167-26976205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26974406 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 262 (V262I)
Ref Sequence ENSEMBL: ENSMUSP00000112778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081285] [ENSMUST00000120016] [ENSMUST00000133257] [ENSMUST00000177932] [ENSMUST00000194598] [ENSMUST00000201702] [ENSMUST00000228963] [ENSMUST00000229490] [ENSMUST00000231853]
Predicted Effect probably benign
Transcript: ENSMUST00000081285
SMART Domains Protein: ENSMUSP00000080038
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120016
AA Change: V262I

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112778
Gene: ENSMUSG00000079605
AA Change: V262I

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
BTB 48 142 4.08e-21 SMART
low complexity region 144 164 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
ZnF_C2H2 397 419 1.36e-2 SMART
ZnF_C2H2 424 444 4.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133257
SMART Domains Protein: ENSMUSP00000115777
Gene: ENSMUSG00000048731

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
internal_repeat_1 264 280 1.14e-6 PROSPERO
Pfam:Ubiquitin_3 281 368 1.5e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177932
SMART Domains Protein: ENSMUSP00000137587
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193200
SMART Domains Protein: ENSMUSP00000141245
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 12 238 1.5e-10 SMART
C2 248 347 4.8e-12 SMART
RasGAP 377 714 2.1e-120 SMART
low complexity region 772 788 N/A INTRINSIC
low complexity region 923 958 N/A INTRINSIC
low complexity region 1025 1053 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
coiled coil region 1171 1244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194598
SMART Domains Protein: ENSMUSP00000141686
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201186
Predicted Effect probably benign
Transcript: ENSMUST00000201349
SMART Domains Protein: ENSMUSP00000144666
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
RasGAP 9 346 2.2e-120 SMART
low complexity region 404 420 N/A INTRINSIC
low complexity region 555 590 N/A INTRINSIC
low complexity region 657 685 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
Blast:RasGAP 761 876 3e-21 BLAST
low complexity region 884 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201702
SMART Domains Protein: ENSMUSP00000144248
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 1.5e-10 SMART
C2 263 362 4.9e-12 SMART
RasGAP 392 729 2.2e-120 SMART
low complexity region 773 789 N/A INTRINSIC
low complexity region 924 959 N/A INTRINSIC
low complexity region 1026 1054 N/A INTRINSIC
low complexity region 1096 1111 N/A INTRINSIC
coiled coil region 1171 1243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202049
Predicted Effect probably benign
Transcript: ENSMUST00000202208
Predicted Effect probably benign
Transcript: ENSMUST00000228963
Predicted Effect probably benign
Transcript: ENSMUST00000229490
Predicted Effect probably benign
Transcript: ENSMUST00000231853
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Other mutations in Zbtb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Zbtb9 APN 17 26975011 unclassified probably benign
IGL02266:Zbtb9 APN 17 26974155 missense probably benign 0.00
IGL03192:Zbtb9 APN 17 26974298 missense probably benign 0.01
PIT4377001:Zbtb9 UTSW 17 26974761 missense probably damaging 1.00
R0655:Zbtb9 UTSW 17 26974100 missense probably damaging 1.00
R1386:Zbtb9 UTSW 17 26974638 missense probably damaging 1.00
R1928:Zbtb9 UTSW 17 26974638 missense probably damaging 1.00
R2035:Zbtb9 UTSW 17 26974923 missense probably damaging 1.00
R2208:Zbtb9 UTSW 17 26974124 missense possibly damaging 0.90
R4196:Zbtb9 UTSW 17 26973879 missense probably benign 0.20
R7202:Zbtb9 UTSW 17 26974692 missense probably damaging 1.00
R8225:Zbtb9 UTSW 17 26974785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTCAGATGTGGCAAGTGGTAG -3'
(R):5'- AGGACAGCAAGTATCTCAGCTCCTC -3'

Sequencing Primer
(F):5'- GTGCTCAGAGATTCTTCGAGAAC -3'
(R):5'- AGCTCCTCCTTCTCCTCAGAG -3'
Posted On2014-03-14