Incidental Mutation 'R1350:Dntt'
ID159552
Institutional Source Beutler Lab
Gene Symbol Dntt
Ensembl Gene ENSMUSG00000025014
Gene Namedeoxynucleotidyltransferase, terminal
SynonymsTdt
MMRRC Submission 039415-MU
Accession Numbers

Genbank: NM_009345 ; MGI: 98659

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1350 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location41029275-41059523 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 41037139 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051806] [ENSMUST00000112200]
Predicted Effect probably benign
Transcript: ENSMUST00000051806
SMART Domains Protein: ENSMUSP00000062078
Gene: ENSMUSG00000025014

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 529 5.68e-196 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112200
SMART Domains Protein: ENSMUSP00000107819
Gene: ENSMUSG00000025014

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 509 1.19e-198 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DNA polymerase type-X family and encodes a template-independent DNA polymerase that catalyzes the addition of deoxynucleotides to the 3'-hydroxyl terminus of oligonucleotide primers. In vivo, the encoded protein is expressed in a restricted population of normal and malignant pre-B and pre-T lymphocytes during early differentiation, where it generates antigen receptor diversity by synthesizing non-germ line elements (N-regions) at the junctions of rearranged Ig heavy chain and T cell receptor gene segments. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in lack of "N" nucleotide insertions at the junctions of immunoglobulin and T cell receptor V(D)J rearrangements. Forced expression of terminal deoxynucleotidyl transferase in fetal thymus leads to decreased gamma-delta T cell number. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Dntt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Dntt APN 19 41039823 missense probably benign 0.01
IGL01531:Dntt APN 19 41053238 nonsense probably null
IGL01859:Dntt APN 19 41037304 missense probably benign
IGL02053:Dntt APN 19 41046274 missense probably benign 0.00
IGL02411:Dntt APN 19 41052985 splice site probably null
IGL03180:Dntt APN 19 41029551 missense probably benign 0.09
R0106:Dntt UTSW 19 41055746 splice site probably benign
R0122:Dntt UTSW 19 41053038 missense possibly damaging 0.95
R0194:Dntt UTSW 19 41038970 missense possibly damaging 0.90
R0266:Dntt UTSW 19 41059127 missense probably damaging 0.99
R0377:Dntt UTSW 19 41047627 nonsense probably null
R0412:Dntt UTSW 19 41042933 missense probably damaging 1.00
R0604:Dntt UTSW 19 41053149 missense probably benign 0.01
R1577:Dntt UTSW 19 41055785 missense probably damaging 1.00
R1677:Dntt UTSW 19 41029484 missense probably benign 0.26
R2567:Dntt UTSW 19 41041336 missense possibly damaging 0.81
R4380:Dntt UTSW 19 41053233 missense probably damaging 1.00
R4703:Dntt UTSW 19 41039803 missense probably benign 0.00
R4999:Dntt UTSW 19 41039856 missense probably damaging 0.99
R6257:Dntt UTSW 19 41053062 missense probably damaging 1.00
R6757:Dntt UTSW 19 41037162 missense probably damaging 1.00
R7340:Dntt UTSW 19 41058565 critical splice acceptor site probably null
R7388:Dntt UTSW 19 41038979 missense probably benign 0.01
R7553:Dntt UTSW 19 41029487 missense probably damaging 0.99
R7806:Dntt UTSW 19 41029632 missense probably benign 0.02
R8145:Dntt UTSW 19 41055785 missense probably damaging 1.00
YA93:Dntt UTSW 19 41053187 missense probably benign
Z1177:Dntt UTSW 19 41055815 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAGCAGGTTGCCCTGTGATAC -3'
(R):5'- TGGATTCTGATGCCCATGCCAGTG -3'

Sequencing Primer
(F):5'- ACCAGGATGGATGTAGCCTC -3'
(R):5'- CTTACAACAAGCTGATGTCTCC -3'
Posted On2014-03-14