Incidental Mutation 'R1350:Vwa2'
ID159553
Institutional Source Beutler Lab
Gene Symbol Vwa2
Ensembl Gene ENSMUSG00000025082
Gene Namevon Willebrand factor A domain containing 2
SynonymsAmaco
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1350 (G1)
Quality Score105
Status Validated
Chromosome19
Chromosomal Location56874249-56912078 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56909126 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 621 (M621K)
Ref Sequence ENSEMBL: ENSMUSP00000026068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026068] [ENSMUST00000111584] [ENSMUST00000118800] [ENSMUST00000122359]
Predicted Effect probably damaging
Transcript: ENSMUST00000026068
AA Change: M621K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026068
Gene: ENSMUSG00000025082
AA Change: M621K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 49 222 6.9e-35 SMART
EGF 297 332 2.99e-4 SMART
VWA 340 517 1.26e-28 SMART
VWA 528 705 1.55e-37 SMART
EGF 714 747 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111584
SMART Domains Protein: ENSMUSP00000107210
Gene: ENSMUSG00000025083

DomainStartEndE-ValueType
Blast:PH 30 153 3e-60 BLAST
low complexity region 160 170 N/A INTRINSIC
PH 194 291 9.27e-9 SMART
PH 372 467 3.11e-10 SMART
low complexity region 531 543 N/A INTRINSIC
low complexity region 611 626 N/A INTRINSIC
coiled coil region 675 772 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118800
SMART Domains Protein: ENSMUSP00000113745
Gene: ENSMUSG00000025083

DomainStartEndE-ValueType
Blast:PH 12 135 3e-60 BLAST
low complexity region 142 152 N/A INTRINSIC
PH 176 273 9.27e-9 SMART
PH 354 449 3.11e-10 SMART
low complexity region 513 525 N/A INTRINSIC
low complexity region 593 608 N/A INTRINSIC
coiled coil region 657 754 N/A INTRINSIC
low complexity region 773 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122359
SMART Domains Protein: ENSMUSP00000112387
Gene: ENSMUSG00000025083

DomainStartEndE-ValueType
Blast:PH 1 79 3e-32 BLAST
low complexity region 86 96 N/A INTRINSIC
PH 120 217 9.27e-9 SMART
PH 298 393 3.11e-10 SMART
low complexity region 457 469 N/A INTRINSIC
low complexity region 537 552 N/A INTRINSIC
coiled coil region 601 698 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
Meta Mutation Damage Score 0.3476 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the von Willebrand factor A-like domain protein superfamily. The encoded protein is localized to the extracellular matrix and may serve as a structural component in basement membranes or in anchoring structures on scaffolds of collagen VII or fibrillin. This gene has been linked to type 1A diabetes and is a candidate serological marker for colon cancer. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Vwa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Vwa2 APN 19 56901634 missense probably damaging 0.98
IGL02081:Vwa2 APN 19 56902236 missense probably benign 0.00
IGL02738:Vwa2 APN 19 56897929 missense possibly damaging 0.62
H8786:Vwa2 UTSW 19 56909732 missense possibly damaging 0.90
R0510:Vwa2 UTSW 19 56898068 splice site probably benign
R1061:Vwa2 UTSW 19 56908994 missense probably benign 0.35
R1403:Vwa2 UTSW 19 56881138 missense unknown
R1403:Vwa2 UTSW 19 56881138 missense unknown
R1918:Vwa2 UTSW 19 56908934 missense probably benign 0.07
R2046:Vwa2 UTSW 19 56905578 missense probably benign 0.08
R3943:Vwa2 UTSW 19 56909315 missense probably damaging 1.00
R4278:Vwa2 UTSW 19 56903483 missense probably benign 0.00
R4745:Vwa2 UTSW 19 56906886 missense probably benign
R5081:Vwa2 UTSW 19 56909320 missense probably damaging 1.00
R5750:Vwa2 UTSW 19 56909231 missense probably benign 0.00
R5959:Vwa2 UTSW 19 56881172 missense possibly damaging 0.96
R6151:Vwa2 UTSW 19 56903465 critical splice acceptor site probably null
R6361:Vwa2 UTSW 19 56901526 critical splice acceptor site probably null
R6861:Vwa2 UTSW 19 56901593 missense probably benign 0.03
R7286:Vwa2 UTSW 19 56909359 missense probably benign
R7653:Vwa2 UTSW 19 56909335 missense probably benign 0.00
R7752:Vwa2 UTSW 19 56909240 missense probably damaging 1.00
R8038:Vwa2 UTSW 19 56897888 missense probably benign 0.43
X0020:Vwa2 UTSW 19 56909201 missense probably damaging 1.00
X0066:Vwa2 UTSW 19 56886985 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCAGAGCTTCATCAGGAAATGCAC -3'
(R):5'- TGTAAGCTGCCACATGGATCAGGG -3'

Sequencing Primer
(F):5'- GATGTGAATCCTGATGTGACAC -3'
(R):5'- CCACATGGATCAGGGAGTCG -3'
Posted On2014-03-14