Incidental Mutation 'R1416:Wdr64'
ID159558
Institutional Source Beutler Lab
Gene Symbol Wdr64
Ensembl Gene ENSMUSG00000026523
Gene NameWD repeat domain 64
Synonyms4930511H01Rik, 4930415O10Rik
MMRRC Submission 039472-MU
Accession Numbers

Ncbi RefSeq: NM_029453.2; MGI:1923070

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1416 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location175698593-175815734 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 175806002 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 940 (T940A)
Ref Sequence ENSEMBL: ENSMUSP00000128678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094288] [ENSMUST00000171939] [ENSMUST00000194087] [ENSMUST00000194783]
Predicted Effect probably benign
Transcript: ENSMUST00000094288
AA Change: T950A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000091846
Gene: ENSMUSG00000026523
AA Change: T950A

DomainStartEndE-ValueType
WD40 118 159 2.65e1 SMART
WD40 162 200 2.13e1 SMART
low complexity region 259 271 N/A INTRINSIC
Blast:WD40 277 316 5e-19 BLAST
WD40 323 361 2.4e-1 SMART
WD40 365 404 8.29e-1 SMART
WD40 407 449 1.7e2 SMART
WD40 457 493 1.19e1 SMART
WD40 497 538 4.55e-3 SMART
WD40 643 684 3.31e0 SMART
WD40 742 806 7.4e0 SMART
Blast:WD40 811 851 7e-17 BLAST
WD40 864 903 4.62e-4 SMART
Blast:XPGN 921 964 9e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171939
AA Change: T940A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000128678
Gene: ENSMUSG00000026523
AA Change: T940A

DomainStartEndE-ValueType
WD40 151 190 5.73e0 SMART
low complexity region 249 261 N/A INTRINSIC
Blast:WD40 267 306 4e-19 BLAST
WD40 313 351 2.4e-1 SMART
WD40 355 394 8.29e-1 SMART
WD40 397 439 1.7e2 SMART
WD40 447 483 1.19e1 SMART
WD40 487 528 4.55e-3 SMART
WD40 633 674 3.31e0 SMART
WD40 732 796 7.4e0 SMART
Blast:WD40 801 841 5e-17 BLAST
WD40 854 893 4.62e-4 SMART
Blast:XPGN 911 954 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194087
AA Change: T940A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000141740
Gene: ENSMUSG00000026523
AA Change: T940A

DomainStartEndE-ValueType
WD40 151 190 3.6e-2 SMART
low complexity region 249 261 N/A INTRINSIC
Blast:WD40 267 305 5e-19 BLAST
WD40 313 351 1.5e-3 SMART
WD40 355 394 5.2e-3 SMART
WD40 397 439 1.1e0 SMART
WD40 447 483 7.6e-2 SMART
WD40 487 528 2.9e-5 SMART
WD40 633 674 2.1e-2 SMART
WD40 732 796 4.7e-2 SMART
Blast:WD40 801 841 6e-17 BLAST
WD40 854 893 2.9e-6 SMART
Blast:XPGN 911 954 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194783
AA Change: T499A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000141384
Gene: ENSMUSG00000026523
AA Change: T499A

DomainStartEndE-ValueType
WD40 6 42 7.6e-2 SMART
WD40 46 87 2.9e-5 SMART
WD40 192 233 2.1e-2 SMART
WD40 291 355 4.7e-2 SMART
Blast:WD40 360 400 4e-17 BLAST
WD40 413 452 2.9e-6 SMART
Blast:XPGN 470 519 3e-19 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 94% (63/67)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C T 15: 8,246,938 Q2689* probably null Het
4932429P05Rik A T X: 89,753,677 M372L probably benign Het
Acad11 T C 9: 104,073,623 S49P probably damaging Het
Afm T C 5: 90,526,379 I250T possibly damaging Het
Alox5 G A 6: 116,423,145 Q278* probably null Het
Anxa7 G A 14: 20,462,707 R253C probably damaging Het
Arfgef1 T A 1: 10,172,939 T1059S probably damaging Het
Arpp21 T C 9: 112,179,129 E101G probably damaging Het
Bcr A T 10: 75,061,506 I161F possibly damaging Het
Ccdc141 T C 2: 77,014,796 E1309G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cep41 C T 6: 30,657,357 S233N probably damaging Het
Col5a1 T G 2: 27,922,064 S53A unknown Het
Efnb2 A G 8: 8,622,329 probably null Het
Epb41l5 T C 1: 119,549,876 probably benign Het
Eri2 A G 7: 119,791,174 F77S probably damaging Het
Ern1 C T 11: 106,421,980 probably benign Het
Eya3 T C 4: 132,707,129 probably benign Het
Fam122b T C X: 53,246,146 *256W probably null Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Icos T C 1: 60,994,643 L144P probably damaging Het
Ipo8 A G 6: 148,789,093 V717A probably benign Het
Lrp12 T C 15: 39,878,623 E232G probably damaging Het
Lrp1b A G 2: 40,998,216 I2344T probably damaging Het
Mettl5 A T 2: 69,871,289 F207I possibly damaging Het
Mtor G T 4: 148,491,414 E1342* probably null Het
Nrap A G 19: 56,327,293 Y1360H possibly damaging Het
Nsun7 T C 5: 66,261,080 V51A probably damaging Het
Olfr1065 T C 2: 86,445,320 I221V probably benign Het
Olfr1160 T A 2: 88,006,571 Y60F probably damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr235 C A 19: 12,268,894 F221L probably benign Het
Olfr467 T C 7: 107,815,262 L228P probably damaging Het
Otud6b A C 4: 14,818,473 L143V probably damaging Het
Pp2d1 T C 17: 53,515,807 N77S probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raly G T 2: 154,857,353 G26* probably null Het
Rarb T C 14: 16,435,177 M290V possibly damaging Het
Rusc2 A G 4: 43,421,617 E679G possibly damaging Het
Scap T C 9: 110,384,773 V1268A probably damaging Het
Setd1b C T 5: 123,160,685 probably benign Het
Shisa3 C G 5: 67,611,434 P226A probably benign Het
Smox C T 2: 131,522,131 S481F probably damaging Het
Stard9 T C 2: 120,700,972 V2570A probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Sult4a1 C T 15: 84,086,646 R186Q probably benign Het
Taf2 G T 15: 55,038,410 A796E possibly damaging Het
Taf4b T C 18: 14,821,427 probably benign Het
Thbs4 G T 13: 92,761,533 Q593K probably benign Het
Tigd3 T C 19: 5,891,725 D459G probably benign Het
Tmem168 A T 6: 13,591,401 L472Q probably damaging Het
Tmem169 G T 1: 72,300,716 V102F probably damaging Het
Tmem241 T C 18: 11,993,574 T274A probably benign Het
Trip10 A G 17: 57,250,800 Y28C probably damaging Het
Ubp1 T C 9: 113,970,171 V398A probably benign Het
Ubr3 A G 2: 69,945,071 Y567C probably damaging Het
Uckl1 A T 2: 181,569,569 M489K possibly damaging Het
Ush2a C T 1: 188,436,883 P1074S probably damaging Het
Vmn1r62 T C 7: 5,675,905 V195A probably damaging Het
Vmn2r63 T A 7: 42,927,915 I400L probably benign Het
Vmn2r67 T A 7: 85,151,616 I371F probably benign Het
Zfp105 A T 9: 122,930,677 Y471F probably damaging Het
Zfp287 A T 11: 62,714,340 H580Q probably damaging Het
Other mutations in Wdr64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Wdr64 APN 1 175698800 missense probably benign 0.00
IGL00902:Wdr64 APN 1 175728825 missense probably damaging 1.00
IGL01347:Wdr64 APN 1 175720333 missense probably benign 0.12
IGL01353:Wdr64 APN 1 175731585 missense probably damaging 0.96
IGL01583:Wdr64 APN 1 175767156 critical splice donor site probably null
IGL01643:Wdr64 APN 1 175772311 missense probably damaging 1.00
IGL01673:Wdr64 APN 1 175800356 missense possibly damaging 0.68
IGL01992:Wdr64 APN 1 175706071 missense probably damaging 1.00
IGL02613:Wdr64 APN 1 175767047 nonsense probably null
IGL02834:Wdr64 APN 1 175805849 splice site probably benign
IGL03214:Wdr64 APN 1 175743635 splice site probably benign
IGL03305:Wdr64 APN 1 175755586 missense possibly damaging 0.94
IGL03308:Wdr64 APN 1 175766996 unclassified probably benign
PIT4418001:Wdr64 UTSW 1 175743594 nonsense probably null
R0036:Wdr64 UTSW 1 175728930 nonsense probably null
R0041:Wdr64 UTSW 1 175726471 nonsense probably null
R0041:Wdr64 UTSW 1 175726471 nonsense probably null
R0079:Wdr64 UTSW 1 175795102 missense probably benign 0.02
R0380:Wdr64 UTSW 1 175769642 splice site probably benign
R0486:Wdr64 UTSW 1 175795203 splice site probably benign
R0520:Wdr64 UTSW 1 175726392 missense probably damaging 1.00
R0598:Wdr64 UTSW 1 175805899 missense probably damaging 1.00
R0711:Wdr64 UTSW 1 175772185 missense probably benign 0.39
R0746:Wdr64 UTSW 1 175792973 missense possibly damaging 0.92
R0927:Wdr64 UTSW 1 175793081 missense probably damaging 0.97
R0947:Wdr64 UTSW 1 175775749 missense probably benign
R1014:Wdr64 UTSW 1 175755626 missense probably damaging 1.00
R1332:Wdr64 UTSW 1 175795140 missense possibly damaging 0.82
R1421:Wdr64 UTSW 1 175767150 missense possibly damaging 0.85
R1467:Wdr64 UTSW 1 175775722 missense probably benign 0.00
R1467:Wdr64 UTSW 1 175775722 missense probably benign 0.00
R1796:Wdr64 UTSW 1 175717331 missense probably damaging 1.00
R1797:Wdr64 UTSW 1 175812019 missense probably damaging 1.00
R2145:Wdr64 UTSW 1 175767095 missense probably benign 0.01
R2321:Wdr64 UTSW 1 175795087 missense possibly damaging 0.57
R2449:Wdr64 UTSW 1 175698913 missense probably benign
R4049:Wdr64 UTSW 1 175805856 missense probably benign 0.21
R4155:Wdr64 UTSW 1 175769606 missense probably benign 0.03
R4624:Wdr64 UTSW 1 175772263 missense probably benign
R4661:Wdr64 UTSW 1 175726494 missense probably damaging 1.00
R4711:Wdr64 UTSW 1 175799229 missense probably damaging 1.00
R4891:Wdr64 UTSW 1 175698779 unclassified probably benign
R4925:Wdr64 UTSW 1 175724702 splice site probably null
R4943:Wdr64 UTSW 1 175720316 missense probably benign 0.01
R5000:Wdr64 UTSW 1 175726375 splice site probably null
R5001:Wdr64 UTSW 1 175792959 critical splice acceptor site probably null
R5143:Wdr64 UTSW 1 175726413 missense probably damaging 1.00
R5395:Wdr64 UTSW 1 175755598 missense probably damaging 1.00
R5813:Wdr64 UTSW 1 175812057 missense possibly damaging 0.89
R6014:Wdr64 UTSW 1 175805990 missense possibly damaging 0.56
R6417:Wdr64 UTSW 1 175726390 missense probably damaging 1.00
R6456:Wdr64 UTSW 1 175785609 critical splice donor site probably null
R6555:Wdr64 UTSW 1 175720290 missense probably damaging 1.00
R6576:Wdr64 UTSW 1 175805928 missense possibly damaging 0.82
R6797:Wdr64 UTSW 1 175810610 critical splice donor site probably null
R6891:Wdr64 UTSW 1 175706068 missense probably damaging 1.00
R6959:Wdr64 UTSW 1 175705989 missense probably damaging 1.00
R7205:Wdr64 UTSW 1 175789933 missense probably benign 0.34
R7252:Wdr64 UTSW 1 175775674 missense probably benign 0.00
R7552:Wdr64 UTSW 1 175785581 missense possibly damaging 0.71
R7732:Wdr64 UTSW 1 175789929 missense probably benign
R7777:Wdr64 UTSW 1 175789998 missense possibly damaging 0.71
R7780:Wdr64 UTSW 1 175728976 missense probably damaging 1.00
R7810:Wdr64 UTSW 1 175731526 missense probably benign 0.01
Z1088:Wdr64 UTSW 1 175705985 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TATGCTCTATGGCCCGTGCTCAAG -3'
(R):5'- CCATGAAAACCCTGGGAGTGCTAAG -3'

Sequencing Primer
(F):5'- CCCGTGCTCAAGCTCAC -3'
(R):5'- GGCCCCATATGTAGGACTATATC -3'
Posted On2014-03-14