Incidental Mutation 'R1416:Olfr1160'
ID159566
Institutional Source Beutler Lab
Gene Symbol Olfr1160
Ensembl Gene ENSMUSG00000075141
Gene Nameolfactory receptor 1160
SynonymsMOR173-1, GA_x6K02T2Q125-49498697-49497765
MMRRC Submission 039472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1416 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88000927-88008268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88006571 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 60 (Y60F)
Ref Sequence ENSEMBL: ENSMUSP00000148857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099839] [ENSMUST00000215457]
Predicted Effect probably damaging
Transcript: ENSMUST00000099839
AA Change: Y69F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097427
Gene: ENSMUSG00000075141
AA Change: Y69F

DomainStartEndE-ValueType
Pfam:7tm_4 40 316 1.2e-46 PFAM
Pfam:7tm_1 50 298 2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215457
AA Change: Y60F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 94% (63/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C T 15: 8,246,938 Q2689* probably null Het
4932429P05Rik A T X: 89,753,677 M372L probably benign Het
Acad11 T C 9: 104,073,623 S49P probably damaging Het
Afm T C 5: 90,526,379 I250T possibly damaging Het
Alox5 G A 6: 116,423,145 Q278* probably null Het
Anxa7 G A 14: 20,462,707 R253C probably damaging Het
Arfgef1 T A 1: 10,172,939 T1059S probably damaging Het
Arpp21 T C 9: 112,179,129 E101G probably damaging Het
Bcr A T 10: 75,061,506 I161F possibly damaging Het
Ccdc141 T C 2: 77,014,796 E1309G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cep41 C T 6: 30,657,357 S233N probably damaging Het
Col5a1 T G 2: 27,922,064 S53A unknown Het
Efnb2 A G 8: 8,622,329 probably null Het
Epb41l5 T C 1: 119,549,876 probably benign Het
Eri2 A G 7: 119,791,174 F77S probably damaging Het
Ern1 C T 11: 106,421,980 probably benign Het
Eya3 T C 4: 132,707,129 probably benign Het
Fam122b T C X: 53,246,146 *256W probably null Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Icos T C 1: 60,994,643 L144P probably damaging Het
Ipo8 A G 6: 148,789,093 V717A probably benign Het
Lrp12 T C 15: 39,878,623 E232G probably damaging Het
Lrp1b A G 2: 40,998,216 I2344T probably damaging Het
Mettl5 A T 2: 69,871,289 F207I possibly damaging Het
Mtor G T 4: 148,491,414 E1342* probably null Het
Nrap A G 19: 56,327,293 Y1360H possibly damaging Het
Nsun7 T C 5: 66,261,080 V51A probably damaging Het
Olfr1065 T C 2: 86,445,320 I221V probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr235 C A 19: 12,268,894 F221L probably benign Het
Olfr467 T C 7: 107,815,262 L228P probably damaging Het
Otud6b A C 4: 14,818,473 L143V probably damaging Het
Pp2d1 T C 17: 53,515,807 N77S probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raly G T 2: 154,857,353 G26* probably null Het
Rarb T C 14: 16,435,177 M290V possibly damaging Het
Rusc2 A G 4: 43,421,617 E679G possibly damaging Het
Scap T C 9: 110,384,773 V1268A probably damaging Het
Setd1b C T 5: 123,160,685 probably benign Het
Shisa3 C G 5: 67,611,434 P226A probably benign Het
Smox C T 2: 131,522,131 S481F probably damaging Het
Stard9 T C 2: 120,700,972 V2570A probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Sult4a1 C T 15: 84,086,646 R186Q probably benign Het
Taf2 G T 15: 55,038,410 A796E possibly damaging Het
Taf4b T C 18: 14,821,427 probably benign Het
Thbs4 G T 13: 92,761,533 Q593K probably benign Het
Tigd3 T C 19: 5,891,725 D459G probably benign Het
Tmem168 A T 6: 13,591,401 L472Q probably damaging Het
Tmem169 G T 1: 72,300,716 V102F probably damaging Het
Tmem241 T C 18: 11,993,574 T274A probably benign Het
Trip10 A G 17: 57,250,800 Y28C probably damaging Het
Ubp1 T C 9: 113,970,171 V398A probably benign Het
Ubr3 A G 2: 69,945,071 Y567C probably damaging Het
Uckl1 A T 2: 181,569,569 M489K possibly damaging Het
Ush2a C T 1: 188,436,883 P1074S probably damaging Het
Vmn1r62 T C 7: 5,675,905 V195A probably damaging Het
Vmn2r63 T A 7: 42,927,915 I400L probably benign Het
Vmn2r67 T A 7: 85,151,616 I371F probably benign Het
Wdr64 A G 1: 175,806,002 T940A probably benign Het
Zfp105 A T 9: 122,930,677 Y471F probably damaging Het
Zfp287 A T 11: 62,714,340 H580Q probably damaging Het
Other mutations in Olfr1160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Olfr1160 APN 2 88006644 missense probably damaging 1.00
IGL01321:Olfr1160 APN 2 88006245 missense probably damaging 0.97
IGL02009:Olfr1160 APN 2 88006773 missense probably benign
IGL03409:Olfr1160 APN 2 88005895 missense probably damaging 1.00
R0089:Olfr1160 UTSW 2 88005987 missense probably damaging 1.00
R0685:Olfr1160 UTSW 2 88006418 missense probably damaging 1.00
R1852:Olfr1160 UTSW 2 88006521 missense probably damaging 1.00
R1965:Olfr1160 UTSW 2 88006304 missense probably damaging 1.00
R2206:Olfr1160 UTSW 2 88006235 missense probably benign 0.00
R4853:Olfr1160 UTSW 2 88006104 missense probably damaging 1.00
R5599:Olfr1160 UTSW 2 88006005 missense probably benign 0.44
R6851:Olfr1160 UTSW 2 88005956 missense probably damaging 0.98
R6995:Olfr1160 UTSW 2 88006185 missense probably benign 0.00
R7817:Olfr1160 UTSW 2 88006011 missense probably benign
Z1176:Olfr1160 UTSW 2 88006437 missense probably damaging 0.98
Z31818:Olfr1160 UTSW 2 88005890 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGGGTGCCATGATAGATGGTGA -3'
(R):5'- TGTGGAGAACAGCACTGTGAAGACT -3'

Sequencing Primer
(F):5'- TGCAATGTACCTGTCATAAGCC -3'
(R):5'- GTGAAGACTGAATTCTATCTCCTGG -3'
Posted On2014-03-14