Incidental Mutation 'R1416:Rusc2'
ID159574
Institutional Source Beutler Lab
Gene Symbol Rusc2
Ensembl Gene ENSMUSG00000035969
Gene NameRUN and SH3 domain containing 2
Synonyms
MMRRC Submission 039472-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R1416 (G1)
Quality Score192
Status Validated
Chromosome4
Chromosomal Location43381979-43427088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43421617 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 679 (E679G)
Ref Sequence ENSEMBL: ENSMUSP00000118528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035645] [ENSMUST00000098106] [ENSMUST00000131668] [ENSMUST00000149221] [ENSMUST00000173682]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035645
AA Change: E679G

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038379
Gene: ENSMUSG00000035969
AA Change: E679G

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098106
AA Change: E679G

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095710
Gene: ENSMUSG00000035969
AA Change: E679G

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125393
Predicted Effect possibly damaging
Transcript: ENSMUST00000131668
AA Change: E679G

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118528
Gene: ENSMUSG00000035969
AA Change: E679G

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146710
Predicted Effect probably benign
Transcript: ENSMUST00000149221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154754
Predicted Effect probably benign
Transcript: ENSMUST00000173682
AA Change: K574E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000133715
Gene: ENSMUSG00000035969
AA Change: K574E

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 685 703 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 94% (63/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C T 15: 8,246,938 Q2689* probably null Het
4932429P05Rik A T X: 89,753,677 M372L probably benign Het
Acad11 T C 9: 104,073,623 S49P probably damaging Het
Afm T C 5: 90,526,379 I250T possibly damaging Het
Alox5 G A 6: 116,423,145 Q278* probably null Het
Anxa7 G A 14: 20,462,707 R253C probably damaging Het
Arfgef1 T A 1: 10,172,939 T1059S probably damaging Het
Arpp21 T C 9: 112,179,129 E101G probably damaging Het
Bcr A T 10: 75,061,506 I161F possibly damaging Het
Ccdc141 T C 2: 77,014,796 E1309G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cep41 C T 6: 30,657,357 S233N probably damaging Het
Col5a1 T G 2: 27,922,064 S53A unknown Het
Efnb2 A G 8: 8,622,329 probably null Het
Epb41l5 T C 1: 119,549,876 probably benign Het
Eri2 A G 7: 119,791,174 F77S probably damaging Het
Ern1 C T 11: 106,421,980 probably benign Het
Eya3 T C 4: 132,707,129 probably benign Het
Fam122b T C X: 53,246,146 *256W probably null Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Icos T C 1: 60,994,643 L144P probably damaging Het
Ipo8 A G 6: 148,789,093 V717A probably benign Het
Lrp12 T C 15: 39,878,623 E232G probably damaging Het
Lrp1b A G 2: 40,998,216 I2344T probably damaging Het
Mettl5 A T 2: 69,871,289 F207I possibly damaging Het
Mtor G T 4: 148,491,414 E1342* probably null Het
Nrap A G 19: 56,327,293 Y1360H possibly damaging Het
Nsun7 T C 5: 66,261,080 V51A probably damaging Het
Olfr1065 T C 2: 86,445,320 I221V probably benign Het
Olfr1160 T A 2: 88,006,571 Y60F probably damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr235 C A 19: 12,268,894 F221L probably benign Het
Olfr467 T C 7: 107,815,262 L228P probably damaging Het
Otud6b A C 4: 14,818,473 L143V probably damaging Het
Pp2d1 T C 17: 53,515,807 N77S probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raly G T 2: 154,857,353 G26* probably null Het
Rarb T C 14: 16,435,177 M290V possibly damaging Het
Scap T C 9: 110,384,773 V1268A probably damaging Het
Setd1b C T 5: 123,160,685 probably benign Het
Shisa3 C G 5: 67,611,434 P226A probably benign Het
Smox C T 2: 131,522,131 S481F probably damaging Het
Stard9 T C 2: 120,700,972 V2570A probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Sult4a1 C T 15: 84,086,646 R186Q probably benign Het
Taf2 G T 15: 55,038,410 A796E possibly damaging Het
Taf4b T C 18: 14,821,427 probably benign Het
Thbs4 G T 13: 92,761,533 Q593K probably benign Het
Tigd3 T C 19: 5,891,725 D459G probably benign Het
Tmem168 A T 6: 13,591,401 L472Q probably damaging Het
Tmem169 G T 1: 72,300,716 V102F probably damaging Het
Tmem241 T C 18: 11,993,574 T274A probably benign Het
Trip10 A G 17: 57,250,800 Y28C probably damaging Het
Ubp1 T C 9: 113,970,171 V398A probably benign Het
Ubr3 A G 2: 69,945,071 Y567C probably damaging Het
Uckl1 A T 2: 181,569,569 M489K possibly damaging Het
Ush2a C T 1: 188,436,883 P1074S probably damaging Het
Vmn1r62 T C 7: 5,675,905 V195A probably damaging Het
Vmn2r63 T A 7: 42,927,915 I400L probably benign Het
Vmn2r67 T A 7: 85,151,616 I371F probably benign Het
Wdr64 A G 1: 175,806,002 T940A probably benign Het
Zfp105 A T 9: 122,930,677 Y471F probably damaging Het
Zfp287 A T 11: 62,714,340 H580Q probably damaging Het
Other mutations in Rusc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Rusc2 APN 4 43426116 missense probably damaging 0.97
IGL01474:Rusc2 APN 4 43416434 missense probably damaging 0.98
IGL01541:Rusc2 APN 4 43415840 missense probably benign 0.08
IGL01628:Rusc2 APN 4 43425729 missense probably damaging 1.00
IGL01969:Rusc2 APN 4 43415738 missense probably benign 0.02
IGL02030:Rusc2 APN 4 43416095 missense possibly damaging 0.86
IGL02079:Rusc2 APN 4 43425668 missense probably benign
IGL02115:Rusc2 APN 4 43426136 splice site probably benign
IGL02122:Rusc2 APN 4 43421685 missense possibly damaging 0.67
IGL02350:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02357:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02437:Rusc2 APN 4 43415545 missense probably damaging 1.00
IGL02930:Rusc2 APN 4 43416376 missense probably damaging 0.99
IGL03154:Rusc2 APN 4 43425806 missense probably benign 0.00
P0026:Rusc2 UTSW 4 43415840 missense possibly damaging 0.93
R0036:Rusc2 UTSW 4 43424009 missense probably damaging 1.00
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0114:Rusc2 UTSW 4 43422055 missense probably damaging 1.00
R0255:Rusc2 UTSW 4 43423954 missense probably damaging 1.00
R0471:Rusc2 UTSW 4 43425486 missense probably damaging 0.99
R1381:Rusc2 UTSW 4 43416137 missense probably damaging 1.00
R1413:Rusc2 UTSW 4 43416568 missense probably benign 0.00
R1731:Rusc2 UTSW 4 43426046 missense probably benign
R1864:Rusc2 UTSW 4 43421719 missense possibly damaging 0.49
R1897:Rusc2 UTSW 4 43421749 missense probably damaging 1.00
R2010:Rusc2 UTSW 4 43415212 missense probably benign 0.06
R2212:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R2275:Rusc2 UTSW 4 43416260 missense probably damaging 1.00
R2885:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R2886:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R3412:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3413:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3414:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3852:Rusc2 UTSW 4 43416424 missense probably benign 0.45
R4135:Rusc2 UTSW 4 43425563 missense possibly damaging 0.49
R4272:Rusc2 UTSW 4 43415533 missense probably damaging 1.00
R4574:Rusc2 UTSW 4 43416080 missense probably damaging 0.99
R4888:Rusc2 UTSW 4 43423942 missense probably damaging 1.00
R5010:Rusc2 UTSW 4 43415926 missense probably damaging 1.00
R5071:Rusc2 UTSW 4 43415240 missense probably benign 0.05
R5131:Rusc2 UTSW 4 43414948 missense probably benign 0.03
R5177:Rusc2 UTSW 4 43421805 unclassified probably null
R5540:Rusc2 UTSW 4 43423975 missense probably damaging 1.00
R5561:Rusc2 UTSW 4 43415932 nonsense probably null
R5628:Rusc2 UTSW 4 43425348 missense probably damaging 1.00
R5645:Rusc2 UTSW 4 43425758 missense probably benign 0.06
R6129:Rusc2 UTSW 4 43424271 missense probably damaging 1.00
R6362:Rusc2 UTSW 4 43416416 missense probably benign 0.30
R6633:Rusc2 UTSW 4 43414852 missense probably damaging 0.99
R6980:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R7491:Rusc2 UTSW 4 43426528 missense probably damaging 1.00
R7641:Rusc2 UTSW 4 43425335 missense possibly damaging 0.84
R7698:Rusc2 UTSW 4 43414900 nonsense probably null
R7710:Rusc2 UTSW 4 43416119 missense probably benign 0.07
X0025:Rusc2 UTSW 4 43422226 missense probably benign 0.00
X0066:Rusc2 UTSW 4 43422204 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCCCTTTCCACAGCAGGATG -3'
(R):5'- CCTTGAGCAGTAGAGATAACCAGCG -3'

Sequencing Primer
(F):5'- GCCATCTGTGTGAAAGTCTGAAAC -3'
(R):5'- AGATAACCAGCGGGGCG -3'
Posted On2014-03-14